View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3680_low_17 (Length: 307)
Name: NF3680_low_17
Description: NF3680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3680_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 297
Target Start/End: Complemental strand, 32840415 - 32840137
Alignment:
| Q |
19 |
ttgtcagtccgccggagacacgttttcccgatgaggaggcagtttgcttggttgcagaggcatcttgtcccgtagtggaggcaggtttctttgatccaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
32840415 |
ttgtcagtccgccggagacacgttttgccgatgaggaggcagtttgcttggttgcagaggcatcttgtcccgtactggaggcaggtttctttgatccgga |
32840316 |
T |
|
| Q |
119 |
ggcagattgttccggtgcagaagatgaatgtggttgttgcgaatcaaatggaggtttgtttttgggtgaggatggaggatcttgagagttctttggtgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32840315 |
ggcagattgttccggtgcagaagatgaatgtggttgttgcgaatcagatggaggtttgtttttgggtgaggatggaggatcttgagagttctttggtgat |
32840216 |
T |
|
| Q |
219 |
tgagtcatgttgagaggtttctttctttctgagaaaagagaatatggaaaatgtgaaatgttattatgattgatctgtg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32840215 |
tgagtcatgttgagaggtttctttctttctgagaaaagagaatatggaaaatgtgaaatgttattatgattgatttgtg |
32840137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 297
Target Start/End: Complemental strand, 32834001 - 32833723
Alignment:
| Q |
19 |
ttgtcagtccgccggagacacgttttcccgatgaggaggcagtttgcttggttgcagaggcatcttgtcccgtagtggaggcaggtttctttgatccaga |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32834001 |
ttgtcagtccgccggagacacattttcccgatgaggagggagtttgcttggttgcagaggcatcttgtcccgtagtggaggcaggtttctttgatccggt |
32833902 |
T |
|
| Q |
119 |
ggcagattgttccggtgcagaagatgaatgtggttgttgcgaatcaaatggaggtttgtttttgggtgaggatggaggatcttgagagttctttggtgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32833901 |
ggcagattgttccggtgcagaagatgaatgtggttgttgcgaatcagatggaggtttgtttttgggtgaggatggaggatcttgagagttctttggtgat |
32833802 |
T |
|
| Q |
219 |
tgagtcatgttgagaggtttctttctttctgagaaaagagaatatggaaaatgtgaaatgttattatgattgatctgtg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32833801 |
tgagtcatgttgagaggtttctttctttctgagaaaagagaatatggaaaatgtgaaatgttattatgattgatttgtg |
32833723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 148 - 297
Target Start/End: Complemental strand, 29605472 - 29605323
Alignment:
| Q |
148 |
gtggttgttgcgaatcaaatggaggtttgtttttgggtgaggatggaggatcttgagagttctttggtgattgagtcatgttgagaggtttctttctttc |
247 |
Q |
| |
|
|||||||||| |||||| ||||||||| |||||||| ||||||| ||||||||| ||||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
29605472 |
gtggttgttgtgaatcagatggaggttgatttttgggattggatggaagatcttgaggtttctttggttaatcagtcatgttgagaggtttctttctttc |
29605373 |
T |
|
| Q |
248 |
tgagaaaagagaatatggaaaatgtgaaatgttattatgattgatctgtg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29605372 |
tgagaaaagagaatatggaaaatgtgaaatgttattatgattgatttgtg |
29605323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 197 - 283
Target Start/End: Original strand, 28405748 - 28405835
Alignment:
| Q |
197 |
atcttgagagttctttggtgattgagtcatgttgagaggtttct-ttctttctgagaaaagagaatatggaaaatgtgaaatgttatt |
283 |
Q |
| |
|
||||||| ||||||||||||||||| |||||| |||||||||| |||||||| | |||| || ||| |||||||||| ||||||| |
|
|
| T |
28405748 |
atcttgatcgttctttggtgattgagccatgttaagaggtttctcttctttctcacaaaattgagtatacaaaatgtgaagtgttatt |
28405835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 197 - 289
Target Start/End: Original strand, 19946835 - 19946924
Alignment:
| Q |
197 |
atcttgagagttctttggtgattgagtcatgttgagaggtttctttctttctgagaaaagagaatatggaaaatgtgaaatgttattatgatt |
289 |
Q |
| |
|
|||||| | |||||||| ||| | |||||||||||||| ||| ||||||||| | || |||| |||| |||||||||||||||||| ||||| |
|
|
| T |
19946835 |
atcttgggtgttctttgctgaatcagtcatgttgagagtttt-tttctttctcacaagagag--tatgaaaaatgtgaaatgttattgtgatt |
19946924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University