View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3680_low_20 (Length: 278)
Name: NF3680_low_20
Description: NF3680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3680_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 37200206 - 37200457
Alignment:
| Q |
16 |
cattgttcactgcatacaaagtttcctttaattgccagatatttcataagataaaagatttcaacatttaccactcacttctgaaagttatttcttccct |
115 |
Q |
| |
|
|||||||||||| |||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37200206 |
cattgttcactgtatacaatgtattctttaattgccagatatttcataagataaaagatttcaacatttaccactcacttctgaaagttatttcttccct |
37200305 |
T |
 |
| Q |
116 |
tccatctaaatttccaaacatagactaaaatgtgggccatcaaagtataggatggaccagtagttgtatcaaagtcaactcaaaggcaaagtggatgtgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37200306 |
tccatctaaatttccaaacatagactaaaatgtgggccatcaaagtataggatggaccagtagttgtatcaaagtcaactcaaaggcaaagtggatgtgt |
37200405 |
T |
 |
| Q |
216 |
gggtcccttttcacaccaacatgtcaagttgccaacatgaatgtctgttcat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37200406 |
gggtcccttttcacaccaacatgtcaagttgccaacatgaatgtctgttcat |
37200457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University