View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3682_high_5 (Length: 241)
Name: NF3682_high_5
Description: NF3682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3682_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 145 - 224
Target Start/End: Complemental strand, 15135916 - 15135837
Alignment:
| Q |
145 |
tacctttaaaattagagagttttcatgtcttcttcaagagagaaaatagcaacttgaattaaaaccgttgttttgcattt |
224 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15135916 |
tacctttaaaattaatgagttttcatgtcttcttcaagagagaaaatagcaacttgaattaaaaccgttgttttgcattt |
15135837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 15136048 - 15136000
Alignment:
| Q |
13 |
aatattgcatgtgttgtgttcatacgaagattctagagaggaaagagac |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15136048 |
aatattgcatgtgttgtgttcatatgaagattctagagaggaaagagac |
15136000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University