View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3682_low_7 (Length: 241)

Name: NF3682_low_7
Description: NF3682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3682_low_7
NF3682_low_7
[»] chr6 (2 HSPs)
chr6 (145-224)||(15135837-15135916)
chr6 (13-61)||(15136000-15136048)


Alignment Details
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 145 - 224
Target Start/End: Complemental strand, 15135916 - 15135837
Alignment:
145 tacctttaaaattagagagttttcatgtcttcttcaagagagaaaatagcaacttgaattaaaaccgttgttttgcattt 224  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15135916 tacctttaaaattaatgagttttcatgtcttcttcaagagagaaaatagcaacttgaattaaaaccgttgttttgcattt 15135837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 15136048 - 15136000
Alignment:
13 aatattgcatgtgttgtgttcatacgaagattctagagaggaaagagac 61  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||    
15136048 aatattgcatgtgttgtgttcatatgaagattctagagaggaaagagac 15136000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University