View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3682_low_8 (Length: 220)
Name: NF3682_low_8
Description: NF3682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3682_low_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 7023310 - 7023091
Alignment:
| Q |
1 |
ttgctagcttctgccacctatctggggtgtccttgtcatagatggccaaagcattctcaaatcttttgttctgctttgttgtccaagctgaacttgagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7023310 |
ttgctagcttctgccacctatctggggtgtccttgtcatagatggccaaagcattctcaaatcttttgttctgctttgttgtccaagctgaacttgagga |
7023211 |
T |
 |
| Q |
101 |
cattctagcaacacttatatataaatttataagataagaaaatgatggtaagaaaatttagtgttgtgtgaatgatccaatgaagagttagacattggcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7023210 |
cattctagcaacacttatatataaatttataagataagaaaatgatggtaagaaaatttagtgttgtgtgaatgatccaatgaagagttagacattggcc |
7023111 |
T |
 |
| Q |
201 |
tctaccctttatatatcaat |
220 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
7023110 |
tctaccctttatataccaat |
7023091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 86
Target Start/End: Complemental strand, 52365413 - 52365354
Alignment:
| Q |
27 |
gtgtccttgtcatagatggccaaagcattctcaaatcttttgttctgctttgttgtccaa |
86 |
Q |
| |
|
||||||||||| | || ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52365413 |
gtgtccttgtccaacattgccaacgcattctcaaatcttttgttctgctttgttgtccaa |
52365354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University