View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3683_high_17 (Length: 392)
Name: NF3683_high_17
Description: NF3683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3683_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 18 - 383
Target Start/End: Complemental strand, 24256961 - 24256596
Alignment:
| Q |
18 |
cgttggacaaccgttcacttttcatcaatgtaggttggaatcagacgaaacgtttcgaacctcttcattaaagcttgttcgtggtgaggctttggtgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24256961 |
cgttggacaaccgttcacttttcatcaatgtaggttggaatcagacgaaaggtttcgaacctcttcattaaagcttgttcgtggtgaggctttggtgttt |
24256862 |
T |
 |
| Q |
118 |
aactgtgtcatgcatttgcctcatcttagttaccgggcttcagattctattgcttccttcttgaacggtgccagggagctaggaacaaagctcgtgacat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
24256861 |
aactgtgtcatgcatttgcctcatcttagttaccgggcttcagattctattgcttccttcttgaacggtgccaaggagttaggaacaaagctcgtgacat |
24256762 |
T |
 |
| Q |
218 |
tagtcgaggaggaagtagggcccatcactgatgcaggctttgtgggtttgttcatggattcattacatcgttattctgccatgtatgattcgtttgaggc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
24256761 |
tagtcgaggaggaagtagggcccatcactgatgcaggctttgtgggtttgttcatggattcattacatcgttattctgccatgtatgactcgttcgaggc |
24256662 |
T |
 |
| Q |
318 |
cgggtttcctatgaataaatgggctaggagtttagtggagcaagtatttttaggcccaagaataat |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24256661 |
tgggtttcctatgaataaatgggctaggagtttagtggagcaagtatttttaggcccaagaataat |
24256596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University