View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3683_high_24 (Length: 334)
Name: NF3683_high_24
Description: NF3683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3683_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 11 - 135
Target Start/End: Complemental strand, 43513176 - 43513052
Alignment:
| Q |
11 |
cagagagtcgggtgtaaatagcaaatagataatagttgatgatgattgaaaatatgaaagattggcactcaatccgtagtagggtgtaaatggcaaaaac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43513176 |
cagagagtcgggtgtaaatagcaaatagataatagttgatgatgatgaaaaatatcaaagattggcactcaatctgtagtagggtgtaaatggcaaaaac |
43513077 |
T |
|
| Q |
111 |
agatttgaaatagagcttgagcttc |
135 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43513076 |
agatttgaaatagagcttgagcttc |
43513052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 203 - 316
Target Start/End: Complemental strand, 43512986 - 43512874
Alignment:
| Q |
203 |
acttctaatgtaaaaaatataaaagaataagagattgagcttgaaattgttcctaatgggaatctgaatttgtacgtgtaaataattttagttactacca |
302 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43512986 |
acttctaatgtaaaaa-tataaaagaataagagattgagcttgaaattgttcctaatggggatctgaatttgtacatgtaaataattttagttactacca |
43512888 |
T |
|
| Q |
303 |
atttgagatcagat |
316 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43512887 |
atttgagatcagat |
43512874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University