View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3683_high_28 (Length: 300)
Name: NF3683_high_28
Description: NF3683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3683_high_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 164 - 282
Target Start/End: Original strand, 12651202 - 12651320
Alignment:
| Q |
164 |
tcaacagtttgcaattttgactcaacccaacaagcagagcaatatatctcacttcagtgcttttctctgttgcatctcaatccatggcttctgcaactta |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12651202 |
tcaacagtttgcaattttgactcaacccaacaagcagagcaatatatctcacttcagtgcttttctctgttgcatctcaatccatggcttctgcaactta |
12651301 |
T |
|
| Q |
264 |
taaaaccaaggttagtact |
282 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
12651302 |
taaaaccgaggttagtact |
12651320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 12 - 127
Target Start/End: Original strand, 12651050 - 12651165
Alignment:
| Q |
12 |
agagaatcatgggaagaattaaaatatgaaaaataggctttaatggagtagatgttgactttgtaccagaataaaagcaattaattggtaataaaagctg |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12651050 |
agagaatcatgggaaaaattaaaatatgaaaaataggctttaatggagtagatgttgactttgtaccagaataaaagcaattaattggtaataaaagctg |
12651149 |
T |
|
| Q |
112 |
attcattttgtcagag |
127 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12651150 |
attcattttgtcagag |
12651165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 170 - 282
Target Start/End: Original strand, 12646075 - 12646188
Alignment:
| Q |
170 |
gtttgcaattttgactcaacccaacaagcagagcaatatatctcacttcagtgcttttctctgttgca-tctcaatccatggcttctgcaacttataaaa |
268 |
Q |
| |
|
|||||||| |||||||||||||||||||||| | ||||||||||||||| ||||||||||| || || | ||||||||||||| |||||| |||| | |
|
|
| T |
12646075 |
gtttgcaactttgactcaacccaacaagcagtgtaatatatctcacttctgtgcttttctcagtgtcagtttcaatccatggctgatgcaaccgataaga |
12646174 |
T |
|
| Q |
269 |
ccaaggttagtact |
282 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12646175 |
agaaggttagtact |
12646188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University