View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3683_high_31 (Length: 280)
Name: NF3683_high_31
Description: NF3683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3683_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 113 - 268
Target Start/End: Complemental strand, 36733076 - 36732919
Alignment:
| Q |
113 |
aatatttttaagcatgtaaattcaaaaatatcattaaaggaaagactatcaagctcattaggaaggatttctaaaataacaaaattttaagaatttgtgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36733076 |
aatatttttaagcatgtaaattcaaaaatatcattaaaagaaagactatcaagctcattaggagggatttctaaaataacaaaatttcaagaatttgtgg |
36732977 |
T |
 |
| Q |
213 |
tgaggttgaaattcgcaa-----gttaatcgcacttctattattgtcttatcgctgagtat |
268 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
36732976 |
tgaggttgaaattcgcaagttacgttaatcgcacttc---tattgtcttatcgctaagtat |
36732919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 39 - 84
Target Start/End: Complemental strand, 36733189 - 36733144
Alignment:
| Q |
39 |
tgctattgcaatcggtgataaaaagataatagttgaaattttttca |
84 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36733189 |
tgctattgcaatcggtgatagaaagataatagttgaaattttttca |
36733144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University