View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3683_high_36 (Length: 250)
Name: NF3683_high_36
Description: NF3683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3683_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 96
Target Start/End: Complemental strand, 35364614 - 35364548
Alignment:
| Q |
30 |
agtgaaaaagatgtaaatcgaataggatttcacgagtgtttaaaaataatttataacaattcataga |
96 |
Q |
| |
|
||||| ||| |||||||||||||| | |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35364614 |
agtgagaaatatgtaaatcgaataaggtttcacgagtgtttaaaaataatttatagcaattcataga |
35364548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University