View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3683_high_44 (Length: 202)
Name: NF3683_high_44
Description: NF3683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3683_high_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 33750617 - 33750807
Alignment:
| Q |
1 |
cacttaagcagtcagaagtggttgctcctgatttagagaatgtaaaagatga------gaatgagaacgagaatatgaatcaagaaattcaaagtgagac |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33750617 |
cacttaagcagtcagaagtggttgctcctgatttagagaatgtaaaagatgagaatgagaatgagaacgagaatatgaatcaagaaatgcaaagtgagac |
33750716 |
T |
|
| Q |
95 |
aaatatgggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggatttt |
185 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33750717 |
aaatattggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggatttt |
33750807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 61 - 185
Target Start/End: Original strand, 33735871 - 33735995
Alignment:
| Q |
61 |
acgagaatatgaatcaagaaattcaaagtgagacaaatatgggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttca |
160 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| ||||||||||| || ||||| | ||||||||||||||||||| | || ||| |||||||||| |
|
|
| T |
33735871 |
acgagaatatgaatcaagaaatacaaattgagacaactatgggatttgagagtaataagaattgtgatttttgggatagtatcggagaagctgattttca |
33735970 |
T |
|
| Q |
161 |
acaactgatgaggtttatggatttt |
185 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
33735971 |
acaactaatgaggtttatggatttt |
33735995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 181
Target Start/End: Original strand, 33719203 - 33719321
Alignment:
| Q |
63 |
gagaatatgaatcaagaaattcaaagtgagacaaatatgggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaac |
162 |
Q |
| |
|
|||||||||||||||||||| |||| ||| |||| | ||| |||| |||||||| |||||||||||||| |||||| |||| ||| |||||||||||| |
|
|
| T |
33719203 |
gagaatatgaatcaagaaatgcaaattgaaacaatgacggggtttgagaataataaggattgtgattttttggatagcattggtgaacctgattttcaac |
33719302 |
T |
|
| Q |
163 |
aactgatgaggtttatgga |
181 |
Q |
| |
|
|| | |||| ||||||||| |
|
|
| T |
33719303 |
aatttatgaagtttatgga |
33719321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 76 - 183
Target Start/End: Original strand, 33721214 - 33721327
Alignment:
| Q |
76 |
aagaaattcaaagtgagacaaatatgggatttgggaataatatg---gattgtgatttttgggataggcttggggaaa---ctgattttcaacaactgat |
169 |
Q |
| |
|
||||||| |||| |||||||| ||||||||||||||||||| | || ||||||||||||||||| |||||||| |||||||||||||||| || |
|
|
| T |
33721214 |
aagaaatgcaaattgagacaacgatgggatttgggaataatacgactgaatgtgatttttgggatagtattggggaagaagctgattttcaacaacttat |
33721313 |
T |
|
| Q |
170 |
gaggtttatggatt |
183 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33721314 |
gaggtttatggatt |
33721327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 102 - 185
Target Start/End: Original strand, 32575066 - 32575149
Alignment:
| Q |
102 |
ggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggatttt |
185 |
Q |
| |
|
|||||| | ||| ||||||||||||| |||||||||| | |||||||| ||| |||| ||| | |||||||||||||||||| |
|
|
| T |
32575066 |
ggatttagaaatgatatggattgtgaattttgggatatgattggggaaggtgaatttcggcaagttatgaggtttatggatttt |
32575149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University