View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3683_high_9 (Length: 550)
Name: NF3683_high_9
Description: NF3683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3683_high_9 |
 |  |
|
| [»] scaffold0236 (2 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 9e-90; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 9e-90
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 5569743 - 5569556
Alignment:
| Q |
1 |
agccgtcgtatcgaacccgttctgggggg-actcctctccaactgctcaatgaattttttattggaatgtgtgaggtattggtaactcggattctagagt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
5569743 |
agccgtcgtatcgaacccgttctgggggggactcctctccaactgctcaatgaattttttattggaatgtgtgaggtattagtaactcggattctagaat |
5569644 |
T |
 |
| Q |
100 |
tgctttaaataagactgaattactgcctgttttacactttgatttccacatagacagatatggtctgtctacctacaaattcccttaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5569643 |
tgctttaaataagactgaattactgcctgttttacactttgatttccacagagacagatatggtctgtctacctacaaattcccttaa |
5569556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 125; E-Value: 4e-64
Query Start/End: Original strand, 281 - 473
Target Start/End: Complemental strand, 5569462 - 5569270
Alignment:
| Q |
281 |
aaaaattattgagattgacggcataggatgaaggttcatcgggttgtcaacctagttggatcgccgttggttcctcttgacgctagtcctctcgactaac |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||| || || |
|
|
| T |
5569462 |
aaaaattattgagattgacggcataggatgaaggttcatcgggttatcaacctagttggaacgccgttggttcctcttgacgctagtcatctctcctgac |
5569363 |
T |
 |
| Q |
381 |
tatccaaaaaatatatttgtcaatagagaggtggtgatttttaacgagtaaacaaccacttctgtctggaagaatgaaatgcggtggcacaat |
473 |
Q |
| |
|
|||||||||||||||||| ||| ||| | ||| |||||||||| |||||||||||||||| ||||| ||||||||| |||||||| |||||| |
|
|
| T |
5569362 |
tatccaaaaaatatatttttcaggagacatgtgatgatttttaaggagtaaacaaccacttttgtctcgaagaatgacatgcggtgtcacaat |
5569270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 289 - 337
Target Start/End: Complemental strand, 9266154 - 9266106
Alignment:
| Q |
289 |
ttgagattgacggcataggatgaaggttcatcgggttgtcaacctagtt |
337 |
Q |
| |
|
||||| ||| |||||||||||| |||||| |||||||||| |||||||| |
|
|
| T |
9266154 |
ttgagtttggcggcataggatggaggttcttcgggttgtctacctagtt |
9266106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 70; Significance: 3e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 7 - 108
Target Start/End: Original strand, 2631261 - 2631365
Alignment:
| Q |
7 |
cgtatcgaacccgttctggg-gggactcctctccaactgctcaatgaat--tttttattggaatgtgtgaggtattggtaactcggattctagagttgct |
103 |
Q |
| |
|
|||||| |||||||||| || ||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2631261 |
cgtatctaacccgttctaggtgggactcctctccaactgcccaatgaatattttttattggaatgtgtggggtattggtaactcggattctagagttgct |
2631360 |
T |
 |
| Q |
104 |
ttaaa |
108 |
Q |
| |
|
||||| |
|
|
| T |
2631361 |
ttaaa |
2631365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 300 - 360
Target Start/End: Original strand, 2631743 - 2631803
Alignment:
| Q |
300 |
ggcataggatgaaggttcatcgggttgtcaacctagttggatcgccgttggttcctcttga |
360 |
Q |
| |
|
|||||||||||||| ||||||||| || ||||||||| ||| | ||||| |||||||||| |
|
|
| T |
2631743 |
ggcataggatgaagattcatcggggtgccaacctagtcggaatgtcgttgcttcctcttga |
2631803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236 (Bit Score: 65; Significance: 3e-28; HSPs: 2)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 14 - 111
Target Start/End: Original strand, 6015 - 6114
Alignment:
| Q |
14 |
aacccgttctggggggactcctctccaactgctcaatgaat--tttttattggaatgtgtgaggtattggtaactcggattctagagttgctttaaataa |
111 |
Q |
| |
|
|||||||| | |||||||||| || |||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6015 |
aacccgttatagggggactccacttcaactgctcaataaatattttttattggaatgtgcgaggtattggtaactcggattctagagttgctttaaataa |
6114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 112 - 145
Target Start/End: Original strand, 6231 - 6264
Alignment:
| Q |
112 |
gactgaattactgcctgttttacactttgatttc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6231 |
gactgaattactgcctgttttacactttgatttc |
6264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 289 - 360
Target Start/End: Complemental strand, 12937 - 12866
Alignment:
| Q |
289 |
ttgagattgacggcataggatgaaggttcatcgggttgtcaacctagttggatcgccgttggttcctcttga |
360 |
Q |
| |
|
||||||||||||||||| |||| |||||| ||||| |||||||||||||| | | ||||| |||||||||| |
|
|
| T |
12937 |
ttgagattgacggcatatgatggaggttcttcgggatgtcaacctagttgaaatgtcgttgcttcctcttga |
12866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000008; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 298 - 339
Target Start/End: Complemental strand, 2040149 - 2040108
Alignment:
| Q |
298 |
acggcataggatgaaggttcatcgggttgtcaacctagttgg |
339 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
2040149 |
acggcataggatgaaggttcatcgggatgccaacctagttgg |
2040108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 3399625 - 3399581
Alignment:
| Q |
295 |
ttgacggcataggatgaaggttcatcgggttgtcaacctagttgg |
339 |
Q |
| |
|
|||||||||||||||||||||| ||||| || |||||||||||| |
|
|
| T |
3399625 |
ttgacggcataggatgaaggtttctcggggtgccaacctagttgg |
3399581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 289 - 339
Target Start/End: Complemental strand, 3914325 - 3914275
Alignment:
| Q |
289 |
ttgagattgacggcataggatgaaggttcatcgggttgtcaacctagttgg |
339 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| || |||||||||||| |
|
|
| T |
3914325 |
ttgagattgacggtataggatgagagttcatcggggtgccaacctagttgg |
3914275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University