View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3683_low_34 (Length: 274)
Name: NF3683_low_34
Description: NF3683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3683_low_34 |
 | |
|
| [»] scaffold0076 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 9 - 116
Target Start/End: Original strand, 21279797 - 21279904
Alignment:
| Q |
9 |
agccattggaaaaagaatccaatgttgcaaatgaaatataaattctaatgtaaagaaagatgagaatgatgaagatgctttttaagatatgcatgaaact |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21279797 |
agccattggaaaaagaatccaatgttgcaaatgaaacataaattctaatgtaaagaaagatgagaatgatgaagatgctttttaagatatacatgaaact |
21279896 |
T |
|
| Q |
109 |
gtgtcacg |
116 |
Q |
| |
|
|||||||| |
|
|
| T |
21279897 |
gtgtcacg |
21279904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 168 - 258
Target Start/End: Original strand, 21280162 - 21280252
Alignment:
| Q |
168 |
ctaatctgcaactacagaaacaaacaatacacaaatatatggtaatgttgttaatgttattgtatttactttattcaagccattgcaccat |
258 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21280162 |
ctaatctgcaactacataaacaaacaatacacaaatatatggtaatgttgttaatgttattgtatttactttattcaagccattgcaccat |
21280252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 115
Target Start/End: Original strand, 15643 - 15713
Alignment:
| Q |
46 |
ataaattctaatgtaaagaaagatgagaatgatgaagatgct-ttttaagatatgcatgaaactgtgtcac |
115 |
Q |
| |
|
||||||| |||||| ||| |||||| ||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
15643 |
ataaattataatgttaaggaagatgttaatgatgaagatgctctttttagatacacatgaaactgtgtcac |
15713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University