View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3685_low_10 (Length: 220)
Name: NF3685_low_10
Description: NF3685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3685_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 49809461 - 49809662
Alignment:
| Q |
1 |
ctaattttgttgttgtgtaatatgagccatccgattttagattaataaatgagacggtttacttcatgaaattgcatgtagttactagttactaaaggct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49809461 |
ctaattttgttgttgtgtaatatgagccatccgattttagattaataaatgagacggtttacttcatgaaattgcatgtagttactagttactaaaggct |
49809560 |
T |
|
| Q |
101 |
cctctgttgtatgcttcataagtactactattttggcacgaatcatggaataaaattcgccccaattgttttctaatgtgtatccaatcatagttttaaa |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49809561 |
cctctgttgtatgtttcataagtactactattttggcacgaatcatggaatagaattcgccccaattgttttctaatgtgtatccaatcatagttttaaa |
49809660 |
T |
|
| Q |
201 |
tt |
202 |
Q |
| |
|
|| |
|
|
| T |
49809661 |
tt |
49809662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University