View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3686_high_35 (Length: 235)

Name: NF3686_high_35
Description: NF3686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3686_high_35
NF3686_high_35
[»] chr7 (1 HSPs)
chr7 (19-224)||(40929117-40929322)


Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 40929322 - 40929117
Alignment:
19 gataatgcctatgtttgatgaaaatggtctttgtttgatggcagtacagttagttatatttgtcataatcgcagagttggcagtgtgattatgtcgagtt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40929322 gataatgcctatgtttgatgaaaatggtctttgtttgatggcagtacagttagttatatttgtcataatcgcagagttggcagtgtgattatgtcgagtt 40929223  T
119 atgtatttaatcgatgttataatattttgccttcttaaccaactggcctttcctgctgagtggctgcataaattgcattgttggcattgttattctacac 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40929222 atgtatttaatcgatgttataatattttgccttcttaaccaactggcctttcctgctgagtggctgcataaattgcattgttggcattgttattctacac 40929123  T
219 aggttc 224  Q
     |||||    
40929122 cggttc 40929117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University