View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3686_low_19 (Length: 345)
Name: NF3686_low_19
Description: NF3686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3686_low_19 |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0882 (1 HSPs) |
 |  |  |
|
| [»] scaffold0515 (1 HSPs) |
 |  |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |  |
|
| [»] scaffold0795 (1 HSPs) |
 |  |  |
|
| [»] scaffold0595 (1 HSPs) |
 |  |  |
|
| [»] scaffold0402 (1 HSPs) |
 |  |  |
|
| [»] scaffold0287 (1 HSPs) |
 |  |  |
|
| [»] scaffold0244 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0633 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 70)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 95 - 338
Target Start/End: Complemental strand, 38216743 - 38216501
Alignment:
| Q |
95 |
ttttagaattttgattactcgttacaacaaagacaaaactgattatttactaaaattctagcctctgaagagaattaaattgaaaagagagcagccatgt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38216743 |
ttttagaattttgattactcgttacaacaaagacaaaactgattatttactaaaattctagcctttgaagagaattaaattgaaaagagagcagccatgt |
38216644 |
T |
 |
| Q |
195 |
gcgagatgggtagagtaggattaccatgagcgggcagtgaccacctgatgaatgtggccatgttcatcatcatgtatactcagcacacagaacaagttac |
294 |
Q |
| |
|
|||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38216643 |
gcgagatgggcagagtaggat-accgtgagcgggcagtgaccacctgatgaatgtggccatgttcatcatcatgtatactcagcacacagaacaagttac |
38216545 |
T |
 |
| Q |
295 |
attacatacatactccctgtcccacttttccctatttcatctca |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38216544 |
attacatacatactccctgtcccacttttccctatttcatctca |
38216501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 13634925 - 13634963
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13634925 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
13634963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 13735338 - 13735376
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13735338 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
13735376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 20 - 66
Target Start/End: Original strand, 40344568 - 40344614
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
40344568 |
tccacttatgtgtgtgagtttataatgactttgccatttcgtctatt |
40344614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 19649547 - 19649502
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
19649547 |
tccacttatgtgtgtgagtttataatggctttgtcatttcgtctat |
19649502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 20662601 - 20662646
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20662601 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
20662646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 54
Target Start/End: Complemental strand, 38216804 - 38216770
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtc |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38216804 |
tccacttatgtgtgtgagtttataatgactttgtc |
38216770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 3673884 - 3673847
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3673884 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
3673847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 5917369 - 5917406
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5917369 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
5917406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 10096691 - 10096736
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
10096691 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
10096736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 10286514 - 10286469
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10286514 |
tccacttgtatgtgtgagtttataatgactttgtcatttcgtctat |
10286469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 14188169 - 14188214
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
14188169 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
14188214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 14725389 - 14725426
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14725389 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
14725426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 17919864 - 17919819
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
17919864 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
17919819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 21174639 - 21174684
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| ||||| |
|
|
| T |
21174639 |
tccacttatgtgtgttaggttataatgactttgtcatttcgtctat |
21174684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 24241947 - 24241902
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
24241947 |
tccacttgtgtgtgtgaatttataatgactttgtcatttcgtctat |
24241902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 31639151 - 31639106
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||| ||||| |
|
|
| T |
31639151 |
tccacttatgtgtgtgggtttataatgactttgccatttcgtctat |
31639106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 34642478 - 34642441
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34642478 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
34642441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 37295205 - 37295250
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
37295205 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
37295250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 37817455 - 37817500
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
37817455 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
37817500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 41897903 - 41897948
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
41897903 |
tccacttatgtgtgtgagtttataataattttgtcatttcgtctat |
41897948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 42650247 - 42650292
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||| ||||| |
|
|
| T |
42650247 |
tccacttatgtgtatgagtttataatgactttatcatttcgtctat |
42650292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 42922618 - 42922663
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
42922618 |
tccacttatgtgtgtgagtttataatcgctttgtcatttcgtctat |
42922663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 43105920 - 43105883
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43105920 |
tgtgtgtgagtttataatgactttgtcatttcatctat |
43105883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 7772099 - 7772055
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttcta |
64 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
7772099 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtcta |
7772055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 65
Target Start/End: Original strand, 10006227 - 10006270
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
10006227 |
cacttatgtgtgtgagtttataatgactttaccatttcatctat |
10006270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 30 - 65
Target Start/End: Original strand, 35058414 - 35058449
Alignment:
| Q |
30 |
tgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35058414 |
tgtgtgagtttataatgactttgtcatttcgtctat |
35058449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 25250864 - 25250902
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
25250864 |
tccacttatgtgtgtgagtttataatggctttgccattt |
25250902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 34744315 - 34744277
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
34744315 |
tccacttatgtgtgtgagtttataatggctttgccattt |
34744277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 42007380 - 42007334
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
42007380 |
tccacttatgtgtgtgagtttacaatggttttgtcatttcgtctatt |
42007334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 44604870 - 44604824
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
44604870 |
tccacttatgtgtgtgagtttataatagttttgtcatttcgtctatt |
44604824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 4312212 - 4312257
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4312212 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
4312257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 4430784 - 4430739
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4430784 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
4430739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 4977083 - 4977038
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4977083 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
4977038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 5700688 - 5700651
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
5700688 |
tgtgtgtgagtttataatgactttgccatttcgtctat |
5700651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 5704677 - 5704632
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
5704677 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
5704632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 6317379 - 6317424
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
6317379 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
6317424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 59
Target Start/End: Original strand, 7882937 - 7882974
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
7882937 |
cacttatgtgtgtgagtttataatggctttgccatttc |
7882974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 11565079 - 11565124
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||| |||||||||||| ||||||||||||| ||||| |
|
|
| T |
11565079 |
tccacttgtgtgtttgagtttataataactttgtcatttcatctat |
11565124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 16395460 - 16395497
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
16395460 |
tgtgtgtgagtttataatgactttgccatttcgtctat |
16395497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 17649891 - 17649846
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||| ||| ||||| |
|
|
| T |
17649891 |
tccacttatgcgtgtgagtttataaagactttgtcaattcgtctat |
17649846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 20150300 - 20150345
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
20150300 |
tccacttgtgtgtgtgagtttataatagctttgtcatttcgtctat |
20150345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 20993616 - 20993661
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
20993616 |
tccacttatgtgtgtgagtttataatagctttgccatttcgtctat |
20993661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 23681089 - 23681134
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
23681089 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
23681134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 24430139 - 24430184
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| |||||||||||||||| ||||| ||||||| ||||| |
|
|
| T |
24430139 |
tccacttatatgtgtgagtttataataactttatcatttcatctat |
24430184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 25063419 - 25063464
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
25063419 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
25063464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 25199125 - 25199170
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
25199125 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
25199170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 26675636 - 26675681
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
26675636 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
26675681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 26690773 - 26690818
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
26690773 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
26690818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 27817498 - 27817453
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
27817498 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
27817453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 27849792 - 27849747
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
27849792 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
27849747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 27928237 - 27928282
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
27928237 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
27928282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 28183751 - 28183714
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
28183751 |
tgtgtgtgagtttataatggctttatcatttcttctat |
28183714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 31941083 - 31941046
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatt |
57 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
31941083 |
tccacttatgtgtgtgagtttataatggctttgccatt |
31941046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 32922911 - 32922874
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
32922911 |
tgtgtgtgagtttataatggctttgtcatttcgtctat |
32922874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 33067431 - 33067394
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
33067431 |
tgtgtgtgagtttataatgactttgccatttcgtctat |
33067394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 34143403 - 34143358
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
34143403 |
tccacttatgtgtgtgagtttataatagctttgccatttcgtctat |
34143358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 34540113 - 34540068
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
34540113 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
34540068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 34711604 - 34711559
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
34711604 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
34711559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 35810316 - 35810361
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
35810316 |
tccacttttgtgtataagtttataatgactttgtcatttcgtctat |
35810361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 36586561 - 36586606
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| | ||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
36586561 |
tccacttgtatgtgtgagtttataatggctttgtcatttcgtctat |
36586606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 37708496 - 37708451
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||| ||||||||||| |||||||||||| ||||| |
|
|
| T |
37708496 |
tccacttgtgtgtgtaagtttataatggctttgtcatttcgtctat |
37708451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 37953862 - 37953907
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| |||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
37953862 |
tccacttatatgtgtgagtttataatgattttgccatttcgtctat |
37953907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 38070530 - 38070485
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
38070530 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
38070485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 38953529 - 38953484
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
38953529 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
38953484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 49
Target Start/End: Original strand, 42158638 - 42158667
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgact |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42158638 |
tccacttatgtgtgtgagtttataatgact |
42158667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 43748850 - 43748805
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
43748850 |
tccacttgtgtgtgtgagtttataatgactttgctatttcgtctat |
43748805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 44814942 - 44814987
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
44814942 |
tccacttgtgtgtgtgagtttataatggctttgccatttcatctat |
44814987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 21 - 65
Target Start/End: Complemental strand, 11098122 - 11098078
Alignment:
| Q |
21 |
ccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| ||||| |
|
|
| T |
11098122 |
ccacttatatgtgtgagtttataattgctttgtcatttcatctat |
11098078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 21 - 65
Target Start/End: Complemental strand, 24420049 - 24420005
Alignment:
| Q |
21 |
ccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| |||||| ||||| |
|
|
| T |
24420049 |
ccacttatctgtgtgagtttataataactttgccatttcgtctat |
24420005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 5e-16; HSPs: 37)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 274 - 338
Target Start/End: Complemental strand, 23608881 - 23608821
Alignment:
| Q |
274 |
tcagcacacagaacaagttacattacatacatactccctgtcccacttttccctatttcatctca |
338 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23608881 |
tcagcacacataacaagttacattacatac----tccctgtcccacttttccctatttcatctca |
23608821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 9727574 - 9727619
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9727574 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
9727619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 10318936 - 10318891
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
10318936 |
tccacttatgtgtgtgagattataatgactttgtcatttcgtctat |
10318891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 12473729 - 12473771
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
12473729 |
acttatgtgtgtgagtttataatgattttgtcatttcgtctat |
12473771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 66
Target Start/End: Complemental strand, 30614955 - 30614917
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30614955 |
tgtgtgtgagtttataatgactttgtcatttcgtctatt |
30614917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 5603496 - 5603451
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
5603496 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
5603451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 8487602 - 8487557
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
8487602 |
tccacttatgtgtgtgagtttataatgactttgctatttcgtctat |
8487557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 12795068 - 12795023
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
12795068 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
12795023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 14465866 - 14465829
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14465866 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
14465829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 22721340 - 22721377
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22721340 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
22721377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 24571666 - 24571621
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
24571666 |
tccacttgtgtgtgtaagtttataatgactttgtcatttcgtctat |
24571621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 34539371 - 34539416
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
34539371 |
tccacttatgtgtgtgagtttataatagctttgtcatttcatctat |
34539416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 29451727 - 29451688
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
29451727 |
tccacttgtgtgtgtgagtttataatgactttgccatttc |
29451688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 4891087 - 4891125
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
4891087 |
tccacttatgtgtgtgagtttataatggctttgccattt |
4891125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 8374221 - 8374259
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
8374221 |
tccacttatatgtgtgagtttataatggctttgtcattt |
8374259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 1855085 - 1855130
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
1855085 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
1855130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 2018811 - 2018766
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
2018811 |
tccacttgtgtgtgtaagtttataatgactttgttatttcgtctat |
2018766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 2236313 - 2236358
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
2236313 |
tccacttgtgtgtgtgagtttataatgattttgccatttcgtctat |
2236358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 2314638 - 2314601
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
2314638 |
tgtgtgtgagtttataatgactttgccatttcgtctat |
2314601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 2959072 - 2959117
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
2959072 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
2959117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 4480553 - 4480598
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4480553 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
4480598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 5660478 - 5660523
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
5660478 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
5660523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 6266711 - 6266756
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
6266711 |
tccacttgtgtgtgtgagtttataatggctttgccatttcatctat |
6266756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 7098885 - 7098930
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
7098885 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
7098930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 8329607 - 8329562
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
8329607 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
8329562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 8448191 - 8448146
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
8448191 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
8448146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 8456995 - 8456950
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
8456995 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
8456950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 8939705 - 8939750
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
8939705 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
8939750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 10181124 - 10181169
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
10181124 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
10181169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 10330884 - 10330929
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
10330884 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
10330929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 18861816 - 18861771
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
18861816 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
18861771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 31057911 - 31057956
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
31057911 |
tccacttgtgtgtgtgagtttataatggttttgtcatttcgtctat |
31057956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 31205232 - 31205187
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
31205232 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
31205187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 32107884 - 32107839
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
32107884 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
32107839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 58
Target Start/End: Original strand, 34360736 - 34360769
Alignment:
| Q |
25 |
ttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
34360736 |
ttatatgtgtgagtttataatgactttgtcattt |
34360769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 35164646 - 35164609
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
35164646 |
tgtgtgtgagtttataatggctttgtcatttcgtctat |
35164609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 65
Target Start/End: Complemental strand, 2395601 - 2395561
Alignment:
| Q |
25 |
ttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
2395601 |
ttatgtatgtgagtttataatggctttgtcatttcgtctat |
2395561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 69)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 65
Target Start/End: Original strand, 38261082 - 38261125
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38261082 |
cacttatgtgtgtgagtttataatgactttgtcatttcgtctat |
38261125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 2286142 - 2286105
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2286142 |
tccacttatgtgtgtgagtttataatgactttgtcatt |
2286105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 6384568 - 6384523
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
6384568 |
tccacttatgtgtgtgagtttataatgactttgccatttcgtctat |
6384523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 7264484 - 7264529
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
7264484 |
tccacttatgtgtgtgagtttataatgactttgccatttcgtctat |
7264529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 27339777 - 27339732
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27339777 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
27339732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 6327288 - 6327335
Alignment:
| Q |
18 |
catccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
6327288 |
catccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
6327335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 65
Target Start/End: Original strand, 45594881 - 45594924
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45594881 |
cacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
45594924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 22752883 - 22752837
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
22752883 |
tccacttatgtgtatgagtttataatgactttgccatttcgtctatt |
22752837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 1323762 - 1323807
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
1323762 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
1323807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 2228129 - 2228084
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2228129 |
tccacttgtatgtgtgagtttataatgactttgtcatttcgtctat |
2228084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 3043865 - 3043820
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
3043865 |
tccacttatgtgtgtgagtttataatgactttgcaatttcgtctat |
3043820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 10703940 - 10703895
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
10703940 |
tccacttctgtgtgtgagtttataatggctttgtcatttcgtctat |
10703895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 17895713 - 17895758
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
17895713 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
17895758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 18945003 - 18945048
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
18945003 |
tccacttatgtgtgtgagtttataatggctttgccatttcatctat |
18945048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 30627703 - 30627748
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30627703 |
tccacttgtgtgtgtgagtttacaatgactttgtcatttcgtctat |
30627748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 31717376 - 31717421
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
31717376 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
31717421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 33512876 - 33512921
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
33512876 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
33512921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 35157133 - 35157088
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
35157133 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
35157088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 40809124 - 40809169
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
40809124 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
40809169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 42557551 - 42557506
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
42557551 |
tccacttatgtgtgtgagtttataatgattttgccatttcgtctat |
42557506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 43188619 - 43188656
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43188619 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
43188656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 45041782 - 45041737
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
45041782 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
45041737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 4887564 - 4887517
Alignment:
| Q |
18 |
catccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4887564 |
catccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
4887517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 16862467 - 16862506
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
16862467 |
tccacttgtgtgtgtgagtttatgatgactttgtcatttc |
16862506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 24829112 - 24829069
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
24829112 |
cacttatgtgtgtgagtttacaatgactgtgtcatttcgtctat |
24829069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 28649415 - 28649376
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
28649415 |
tccacttgtgtgtgtgagtttataatgactttatcatttc |
28649376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 30 - 65
Target Start/End: Complemental strand, 31807088 - 31807053
Alignment:
| Q |
30 |
tgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31807088 |
tgtgtgagtttataatgactttgtcatttcgtctat |
31807053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 36254205 - 36254244
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
36254205 |
tccacttgtgtgtgtgagtttataatgactttgccatttc |
36254244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 37117894 - 37117855
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
37117894 |
tccacttgtgtgtgtgagtttataatggctttgtcatttc |
37117855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 65
Target Start/End: Original strand, 48612598 - 48612641
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
48612598 |
cacttatgtgtgtgagtttataatggctttgccatttcgtctat |
48612641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 8522833 - 8522791
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
8522833 |
acttgtgtgtgtgagtttataatgactttgttatttcgtctat |
8522791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 788907 - 788862
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
788907 |
tccacttgtgtgtgtgagtttataatagctttgtcatttcgtctat |
788862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 1869895 - 1869940
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
1869895 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
1869940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 3497566 - 3497521
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
3497566 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
3497521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 3861385 - 3861340
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
3861385 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
3861340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 4106633 - 4106678
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4106633 |
tccacttgtgtgtgtgagtttataatggctttgccatttcatctat |
4106678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 4227413 - 4227458
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4227413 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
4227458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 4674358 - 4674313
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4674358 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
4674313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 5523872 - 5523917
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||| ||||||| |||||||| |||||||||||| ||||| |
|
|
| T |
5523872 |
tccacttatgcgtgtgagattataatggctttgtcatttcgtctat |
5523917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 6369606 - 6369651
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
6369606 |
tccacttatgtgtgtgagtttataatggctttaccatttcgtctat |
6369651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 6378071 - 6378116
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
6378071 |
tccacttatgtgtgtgagtttataatggctttaccatttcgtctat |
6378116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 9234296 - 9234251
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||| ||||||| ||||| |
|
|
| T |
9234296 |
tccacttgtgtgtgtgagtttataatggctttatcatttcgtctat |
9234251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 10061065 - 10061020
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
10061065 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
10061020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 10166948 - 10166993
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||| ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
10166948 |
tccacttgtgtatgtgagtttataatggctttgtcatttcgtctat |
10166993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 12014781 - 12014736
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
12014781 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
12014736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 12961864 - 12961827
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
12961864 |
tgtgtgtgagtttatgatgactttgtcatctcttctat |
12961827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 14817506 - 14817551
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
14817506 |
tccacttgtgtgtatgagtttacaatgactttgtcatttcgtctat |
14817551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 15264502 - 15264547
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
15264502 |
tccacttgtgtgtatgagtttacaatgactttgtcatttcgtctat |
15264547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 16816770 - 16816815
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
16816770 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
16816815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 21226144 - 21226189
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
21226144 |
tccacttgtgtgtgtgagtttataatgtctttgccatttcatctat |
21226189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 28382657 - 28382702
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
28382657 |
tccacttctgtgtgtgagtttataatggctttgccatttcgtctat |
28382702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 29628433 - 29628388
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
29628433 |
tccacttgtgtgtgtgagtttaaaatggctttgtcatttcgtctat |
29628388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 30552483 - 30552528
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| || ||||||||||||| ||||||||||||| ||||| |
|
|
| T |
30552483 |
tccacttatatgcgtgagtttataataactttgtcatttcgtctat |
30552528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 31300036 - 31299999
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
31300036 |
tgtgtgtgagtttataataactttgtcatttcgtctat |
31299999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 33628107 - 33628152
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
33628107 |
tccacttgtgtgtgtgagtttataatggttttgtcatttcatctat |
33628152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 33906370 - 33906407
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
33906370 |
tgtgtgtgagtttataatggctttgtcatttcgtctat |
33906407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 59
Target Start/End: Original strand, 35196962 - 35196991
Alignment:
| Q |
30 |
tgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35196962 |
tgtgtgagtttataatgactttgtcatttc |
35196991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 37920048 - 37920093
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||| | ||||| ||||| |
|
|
| T |
37920048 |
tccacttatgtgtgtgagtttataatggctttattatttcgtctat |
37920093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 38678212 - 38678167
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
38678212 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
38678167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 40012038 - 40011993
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
40012038 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
40011993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 40013343 - 40013388
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
40013343 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
40013388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 40656157 - 40656112
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
40656157 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
40656112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 43723391 - 43723436
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
43723391 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
43723436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 44327719 - 44327764
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
44327719 |
tccacttgtgtgtgtgagtttataatagctttgtcatttcgtctat |
44327764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 45946789 - 45946834
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
45946789 |
tccacttgtgtgtgtgagtttacaatggctttgtcatttcgtctat |
45946834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 47086349 - 47086304
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
47086349 |
tccacttatgtgtgtgagtttataatggctttaccatttcgtctat |
47086304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 48401330 - 48401293
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
48401330 |
tgtgtgtgaatttacaatgactttgtcatttcttctat |
48401293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 48467889 - 48467934
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
48467889 |
tccacttgtgtgtgcgagtttataatggctttgtcatttcgtctat |
48467934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 22 - 66
Target Start/End: Complemental strand, 11074989 - 11074945
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||||| ||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
11074989 |
cacttatgtatgtgagtttataatggctttgccatttcgtctatt |
11074945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 70)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 28983811 - 28983849
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28983811 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
28983849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 939666 - 939711
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
939666 |
tccacttatgtgtgtgagtttataataactttgtcatttcgtctat |
939711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 7413171 - 7413216
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7413171 |
tccacttatatgtgtgagtttataatgactttgtcatttcgtctat |
7413216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 7459251 - 7459296
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7459251 |
tccacttatatgtgtgagtttataatgactttgtcatttcgtctat |
7459296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 18371425 - 18371470
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
18371425 |
tccacttatgtgtgtgagtttataatggctttgtcatttcgtctat |
18371470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 25586376 - 25586331
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
25586376 |
tccacttatgtgtgtgagtttataatggctttgtcatttcgtctat |
25586331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 32233691 - 32233736
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32233691 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
32233736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 35615964 - 35616009
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
35615964 |
tccacttatgtgtgtgagtttataataactttgtcatttcatctat |
35616009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 47462085 - 47462040
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47462085 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
47462040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 27009397 - 27009358
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27009397 |
tccacttatgtatgtgagtttataatgactttgtcatttc |
27009358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 54096989 - 54096950
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54096989 |
tccacttgtgtgtgtgagtttataatgactttgtcatttc |
54096950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 9064837 - 9064799
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9064837 |
tccacttgtgtgtgtgagtttataatgactttgtcattt |
9064799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 17518522 - 17518476
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
17518522 |
tccatttatgtgtgtgagtttataataactttgtcatttcgtctatt |
17518476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 66
Target Start/End: Original strand, 42116559 - 42116605
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
42116559 |
tccacttgtgtgtgtgagtttacaatgactttgtcatttcatctatt |
42116605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 66
Target Start/End: Original strand, 53216091 - 53216137
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
53216091 |
tccacttatgtgtgtgaatttataatcactttgtcatttcgtctatt |
53216137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 54864478 - 54864520
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54864478 |
acttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
54864520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 579291 - 579246
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
579291 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
579246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 3037316 - 3037361
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
3037316 |
tccacttatgtgtgtgagtttataatggttttgtcatttcgtctat |
3037361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 13389099 - 13389144
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
13389099 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
13389144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 17481011 - 17481056
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
17481011 |
tccacttatgtatgtgagtttataatggctttgtcatttcgtctat |
17481056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 28033271 - 28033316
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
28033271 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
28033316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 31263550 - 31263505
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
31263550 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
31263505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 31375192 - 31375237
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
31375192 |
tccacttgtgtgtgtaagtttataatgactttgtcatttcgtctat |
31375237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 31583652 - 31583607
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
31583652 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
31583607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 37050780 - 37050825
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
37050780 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
37050825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 39997822 - 39997777
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
39997822 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
39997777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 42412037 - 42411992
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
42412037 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
42411992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 51425414 - 51425451
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51425414 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
51425451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 51675716 - 51675671
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
51675716 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
51675671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 8810815 - 8810773
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
8810815 |
acttgtgtgtgtgagtttataatgactttgttatttcgtctat |
8810773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 48860084 - 48860126
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
48860084 |
acttgtgtatgtgagtttataatgactttgtcatttcgtctat |
48860126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 5333255 - 5333210
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
5333255 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
5333210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 6487925 - 6487970
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
6487925 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
6487970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 7512846 - 7512891
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
7512846 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
7512891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 7944273 - 7944228
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
7944273 |
tccacttgtgtgtgtgagtttataatggctttgccatttcatctat |
7944228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 9569554 - 9569599
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
9569554 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
9569599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 11371109 - 11371064
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| | ||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
11371109 |
tccacttgtatgtgtgagtttataatgactttgccatttcgtctat |
11371064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 53
Target Start/End: Original strand, 11673371 - 11673404
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgt |
53 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
11673371 |
tccacttatgtgtgtaagtttataatgactttgt |
11673404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 12315979 - 12315934
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
12315979 |
tccacttgtgtgtgtgagtttataatggctttgccatttcatctat |
12315934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 13632169 - 13632214
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
13632169 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
13632214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 14285174 - 14285219
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
14285174 |
tccacttgtgtgtgtgagtttataatggctttgccatttcatctat |
14285219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 16476986 - 16476941
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
16476986 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
16476941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 16971731 - 16971694
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatt |
57 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
16971731 |
tccacttgtgtgtgtgagtttataataactttgtcatt |
16971694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 17846799 - 17846754
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
17846799 |
tccacttgtgtgtgtgagtttctaatgactttgccatttcgtctat |
17846754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 18813449 - 18813494
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
18813449 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
18813494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 23974691 - 23974646
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
23974691 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
23974646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 24550892 - 24550937
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
24550892 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
24550937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 24712167 - 24712212
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
24712167 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
24712212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 25003811 - 25003856
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
25003811 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
25003856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 28010100 - 28010055
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
28010100 |
tccacttgtgtgtgtgagtttataatggctttgccatttcatctat |
28010055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 28187201 - 28187164
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
28187201 |
tgtgtgtgagtttataatgactttgccatttcgtctat |
28187164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 30044633 - 30044588
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
30044633 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
30044588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 32104059 - 32104014
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
32104059 |
tccacttgtgtgtgtgagtttataatggctttgccatttcatctat |
32104014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 33416629 - 33416584
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
33416629 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
33416584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 34567106 - 34567151
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
34567106 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
34567151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 34684281 - 34684326
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
34684281 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
34684326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 36526190 - 36526145
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
36526190 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
36526145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 36752438 - 36752483
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| | ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
36752438 |
tccacttatatatgtgagtttataatggctttgtcatttcgtctat |
36752483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 36860898 - 36860853
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
36860898 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
36860853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 37166217 - 37166262
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
37166217 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
37166262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 42856642 - 42856687
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
42856642 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
42856687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 46488166 - 46488121
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
46488166 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
46488121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 49882758 - 49882713
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
49882758 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
49882713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 50779840 - 50779795
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
50779840 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
50779795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 51281555 - 51281592
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
51281555 |
tgtgtgtgaatttataatgactttgtcatttcgtctat |
51281592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 54086090 - 54086135
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| ||| |||||||||||||| ||||||||||| ||||| |
|
|
| T |
54086090 |
tccacttatatgtatgagtttataatgattttgtcatttcatctat |
54086135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 17271378 - 17271410
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttg |
52 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
17271378 |
tccacttatgtgtgtgagtttataatggctttg |
17271410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 29974429 - 29974393
Alignment:
| Q |
30 |
tgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| |
|
|
| T |
29974429 |
tgtgtgagtttataatgactttgtcatctcgtctatt |
29974393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 65
Target Start/End: Original strand, 39585414 - 39585454
Alignment:
| Q |
25 |
ttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||| || |||||||||| |||||||| |
|
|
| T |
39585414 |
ttatgtgtgtgagtttatgataactttgtcatctcttctat |
39585454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 46343418 - 46343454
Alignment:
| Q |
29 |
gtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
46343418 |
gtgtgtgagtttatgatgactttgtcatctcttctat |
46343454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 74)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 31990030 - 31990068
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31990030 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
31990068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 49285590 - 49285632
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49285590 |
acttatgtgtgtgagtttataatgactttgtcatttcgtctat |
49285632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 19921361 - 19921316
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
19921361 |
tccacttatgtgtgtgagtttataatgactttgccatttcgtctat |
19921316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 27396932 - 27396977
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27396932 |
tccacttgtgtgtgtgagtttataatgactttgccatttcttctat |
27396977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 35359796 - 35359841
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35359796 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
35359841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 36518179 - 36518224
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36518179 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
36518224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 26 - 65
Target Start/End: Complemental strand, 48489471 - 48489432
Alignment:
| Q |
26 |
tatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48489471 |
tatgtgtgtgagtttatgatgactttgtcatttcttctat |
48489432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 59
Target Start/End: Original strand, 29216886 - 29216924
Alignment:
| Q |
21 |
ccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29216886 |
ccacttatgtgtgtgagtttataataactttgtcatttc |
29216924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 47570362 - 47570400
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47570362 |
tccatttatgtgtgtgagtttataatgactttgtcattt |
47570400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 8508011 - 8508056
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
8508011 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
8508056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 11250045 - 11250082
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11250045 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
11250082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 16135081 - 16135118
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatt |
57 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16135081 |
tccacttatgtgtgtgagtttataatggctttgtcatt |
16135118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 23879025 - 23879070
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
23879025 |
tccacttatgtgtgtgagtttacaatgacgttgtcatttcgtctat |
23879070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 35966329 - 35966366
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35966329 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
35966366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 40559753 - 40559798
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
40559753 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
40559798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 40639681 - 40639726
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
40639681 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
40639726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 43904544 - 43904499
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
43904544 |
tccatttatgtgtgtgagtttataataactttgtcatttcgtctat |
43904499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 46311494 - 46311449
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
46311494 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
46311449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 52256801 - 52256756
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
52256801 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
52256756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 2558826 - 2558870
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttcta |
64 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
2558826 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtcta |
2558870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 23525947 - 23525911
Alignment:
| Q |
30 |
tgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23525947 |
tgtgtgagtttataatgactttgtcatttcgtctatt |
23525911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 36540193 - 36540229
Alignment:
| Q |
29 |
gtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36540193 |
gtgtgtgagtttataatgactttgtcatttcgtctat |
36540229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 9493577 - 9493616
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
9493577 |
tccacttgtatgtgtgagtttataatgactttgtcatttc |
9493616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 17501004 - 17501051
Alignment:
| Q |
18 |
catccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
17501004 |
catccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
17501051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 65
Target Start/End: Original strand, 28731928 - 28731971
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
28731928 |
cacttgtgtgtgtgagtttacaatgactttgtcatttcgtctat |
28731971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 26 - 65
Target Start/End: Complemental strand, 48209474 - 48209435
Alignment:
| Q |
26 |
tatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
48209474 |
tatgtgtgtgagcttataatgactttgtcatttcgtctat |
48209435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 11056118 - 11056076
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
11056118 |
acttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
11056076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 32635458 - 32635496
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
32635458 |
tccacttgtgtgtgcgagtttataatgactttgtcattt |
32635496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 39928839 - 39928793
Alignment:
| Q |
18 |
catccacttatgtgtgtgagtttataatgactttgtcatttcttcta |
64 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| |||||| |||| |
|
|
| T |
39928839 |
catccacttatgtgtgtgaatttataatggctttgccatttcgtcta |
39928793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 44037490 - 44037448
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
44037490 |
acttatgtgtgtgagtttataatggttttgtcatttcatctat |
44037448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 66
Target Start/End: Original strand, 44107459 - 44107505
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
44107459 |
tccacttgtgtgtgtgagtttataatagctttgtcatttcgtctatt |
44107505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 46316523 - 46316481
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
46316523 |
acttgtgtgtgtgagtttataataactttgtcatttcgtctat |
46316481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 1242296 - 1242341
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
1242296 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
1242341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 1339299 - 1339344
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
1339299 |
tccacttgtgtgtgtgagtttataatggttttgtcatttcgtctat |
1339344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 3440805 - 3440850
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
3440805 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
3440850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 3917845 - 3917890
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
3917845 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
3917890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 4232226 - 4232181
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4232226 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
4232181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 5998831 - 5998786
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
5998831 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
5998786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 6083191 - 6083146
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
6083191 |
tccacttgtgtgtgtgagtttataatggttttgtcatttcgtctat |
6083146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 7552674 - 7552719
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
7552674 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
7552719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 8128339 - 8128294
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
8128339 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
8128294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 8381158 - 8381203
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
8381158 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
8381203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 9318604 - 9318641
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
9318604 |
tgtgtgtgagtttataatgattttgtcatttcgtctat |
9318641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 9583472 - 9583427
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
9583472 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
9583427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 10229036 - 10229081
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
10229036 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
10229081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 10473963 - 10473918
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
10473963 |
tccacttgtgtgtgtgagtttataatggctttgccatttcatctat |
10473918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 11029743 - 11029788
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
11029743 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
11029788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 11076484 - 11076529
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
11076484 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
11076529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 12088331 - 12088286
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
12088331 |
tccacttgtgtgtgtgagtttataatggatttgtcatttcgtctat |
12088286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 13525248 - 13525293
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
13525248 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
13525293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 14868904 - 14868859
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| |||||| ||||| |
|
|
| T |
14868904 |
tccacttatgtgtgtgaatttataatggctttgccatttcgtctat |
14868859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 15003707 - 15003752
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
15003707 |
tccacctatgtgtgtgagtttataatggctttgccatttcgtctat |
15003752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 19163713 - 19163758
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
19163713 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
19163758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 24910337 - 24910292
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
24910337 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
24910292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 62
Target Start/End: Original strand, 26100596 - 26100633
Alignment:
| Q |
25 |
ttatgtgtgtgagtttataatgactttgtcatttcttc |
62 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
26100596 |
ttatgtgtgtgagtttatgatgaatttgtcatttcttc |
26100633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 27002789 - 27002744
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
27002789 |
tccacttgtgtgtgtgagtttataatggttttgtcatttcgtctat |
27002744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 32961027 - 32960982
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
32961027 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
32960982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 34397759 - 34397804
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
34397759 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
34397804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 35069402 - 35069439
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
35069402 |
tgtgtgtgagtttataatggctttgtcatttcatctat |
35069439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 37312607 - 37312652
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
37312607 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
37312652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 38127891 - 38127846
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
38127891 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
38127846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 38486008 - 38485963
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
38486008 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
38485963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 43426647 - 43426692
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| |||||| ||||| |
|
|
| T |
43426647 |
tccacttatgtgtatgagtttataatggctttgccatttcgtctat |
43426692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 43898012 - 43897967
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| |||||| ||||| |
|
|
| T |
43898012 |
tccacttgtgtgtgtgagtttacaatgactttgccatttcgtctat |
43897967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 43968002 - 43968047
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||| ||||||| ||||| |
|
|
| T |
43968002 |
tccacttgtgtgtgtgagtttataatggctttatcatttcgtctat |
43968047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 47410801 - 47410756
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
47410801 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
47410756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 48191173 - 48191218
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
48191173 |
tccacttgtgtgtgtgagtttataatggttttgtcatttcgtctat |
48191218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 48555915 - 48555960
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
48555915 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
48555960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 51402902 - 51402947
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
51402902 |
tccacttgtgtgtgtgagtttataatggttttgtcatttcgtctat |
51402947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 54097490 - 54097445
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
54097490 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
54097445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 65
Target Start/End: Original strand, 4659623 - 4659663
Alignment:
| Q |
25 |
ttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||| || ||||| |
|
|
| T |
4659623 |
ttatgtgtgtgagtttataatgactttttcatctcgtctat |
4659663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 21 - 65
Target Start/End: Complemental strand, 6419713 - 6419669
Alignment:
| Q |
21 |
ccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||| | |||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
6419713 |
ccacttgtatgtgtgagtttataataactttgtcatttcgtctat |
6419669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 65
Target Start/End: Complemental strand, 38417768 - 38417728
Alignment:
| Q |
25 |
ttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||| |||||||| || ||||| |
|
|
| T |
38417768 |
ttatgtgtgtgagtttataatgattttgtcatctcgtctat |
38417728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 51891429 - 51891389
Alignment:
| Q |
26 |
tatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||| |||||| |
|
|
| T |
51891429 |
tatgtctgtgagtttataatgactctgtcatttcgtctatt |
51891389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 66)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 23809933 - 23809895
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23809933 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
23809895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 8194011 - 8193966
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
8194011 |
tccacttatgtgtgtgagtttataatgactttgccatttcgtctat |
8193966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 42631034 - 42630989
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42631034 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
42630989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 47429641 - 47429596
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
47429641 |
tccacttatgtgtgtgagtttataatggctttgtcatttcgtctat |
47429596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 49948320 - 49948365
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49948320 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
49948365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 20 - 60
Target Start/End: Complemental strand, 51263862 - 51263822
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttct |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51263862 |
tccacttatgtgtgtgagtttataatgactttatcatttct |
51263822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 6669385 - 6669424
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6669385 |
tccacttatgtgtgtgagtttataatggctttgtcatttc |
6669424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 50145179 - 50145136
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50145179 |
cacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
50145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 23913687 - 23913725
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23913687 |
tccacttatgtgtgtgagtttataataactttgtcattt |
23913725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 1576453 - 1576498
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
1576453 |
tccacttatgtgtgtgagtttataatggttttgtcatttcgtctat |
1576498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 2112826 - 2112871
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
2112826 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
2112871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 5598380 - 5598425
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
5598380 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
5598425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 15331111 - 15331066
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
15331111 |
tccacttgtgtatgtgagtttataatgactttgtcatttcgtctat |
15331066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 24254460 - 24254415
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
24254460 |
tccacttgtgtgtgtgagtttataatgactttatcatttcgtctat |
24254415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 27856076 - 27856121
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
27856076 |
tccacttgtgtgtgtgagtttataatgactttttcatttcgtctat |
27856121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 36586330 - 36586375
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
36586330 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcatctat |
36586375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 43086520 - 43086475
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
43086520 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
43086475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 44623067 - 44623022
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
44623067 |
tccacttatgtatgtgagtttataatggctttgtcatttcgtctat |
44623022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 24 - 65
Target Start/End: Complemental strand, 45007737 - 45007696
Alignment:
| Q |
24 |
cttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
45007737 |
cttatgtgtgtgagtttataatggctttgtcatttcgtctat |
45007696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 48392035 - 48392080
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
48392035 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
48392080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 11403246 - 11403293
Alignment:
| Q |
18 |
catccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||| || |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11403246 |
catccatttgtgtgtgtgagtttataatagctttgtcatttcttctat |
11403293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 29803224 - 29803177
Alignment:
| Q |
18 |
catccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
29803224 |
catccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
29803177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 52492728 - 52492685
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
52492728 |
cacttgtgtgtgtgagtttataatgactttatcatttcgtctat |
52492685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 11786182 - 11786228
Alignment:
| Q |
20 |
tccacttatgtgtgtgagttt-ataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
11786182 |
tccacttgtgtgtgtgagttttataatgactttgtcatttcgtctat |
11786228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 31 - 65
Target Start/End: Original strand, 12663677 - 12663711
Alignment:
| Q |
31 |
gtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12663677 |
gtgtgagtttataatgactttgtcatttcgtctat |
12663711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 19279901 - 19279863
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
19279901 |
tccacttatgtgtatgagtttataatggctttgtcattt |
19279863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 22561207 - 22561169
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
22561207 |
tccacttgtgtgtgtgagtttataataactttgtcattt |
22561169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 23359611 - 23359649
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
23359611 |
tccacttatgtgtgtgagtttataataactttatcattt |
23359649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 66
Target Start/End: Original strand, 24119735 - 24119781
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
24119735 |
tccacttatgtgtgtgagtttataatagctttgccatttcgtctatt |
24119781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 27 - 65
Target Start/End: Complemental strand, 43907266 - 43907228
Alignment:
| Q |
27 |
atgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
43907266 |
atgtgtgtgagtttataatggctttgtcatttcgtctat |
43907228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 48731802 - 48731760
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
48731802 |
acttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
48731760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 65
Target Start/End: Complemental strand, 2208934 - 2208901
Alignment:
| Q |
32 |
tgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
2208934 |
tgtgagtttataatgactttgtcatttcgtctat |
2208901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 4126654 - 4126699
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4126654 |
tccacttgtgtgtgtgagtttataatgcctttgccatttcgtctat |
4126699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 12282693 - 12282738
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| |||||| ||||| |
|
|
| T |
12282693 |
tccacttatgtgtgtaagtttataatggctttgccatttcgtctat |
12282738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 12500584 - 12500539
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||| |||||| |||||| |||||||||||| ||||| |
|
|
| T |
12500584 |
tccacttatgtgtatgagttcataatggctttgtcatttcgtctat |
12500539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 13980355 - 13980310
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
13980355 |
tccacttatgtgtgtgagtttataatagctttgccatttcgtctat |
13980310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 60
Target Start/End: Original strand, 15104126 - 15104163
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttct |
60 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
15104126 |
acttatgtgtgtgagtttataatggctttgccatttct |
15104163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 15906216 - 15906171
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
15906216 |
tccacttatgtgtgtgagtttataatggctttaccatttcgtctat |
15906171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 16261170 - 16261215
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| ||||| |
|
|
| T |
16261170 |
tccacttatgtgtgtgagtttataatagctttatcatttcatctat |
16261215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 59
Target Start/End: Original strand, 16939527 - 16939564
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
16939527 |
cacttatgtgtgtgagtttatgatgcctttgtcatttc |
16939564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 17068231 - 17068276
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
17068231 |
tccacttgtgtgtgtgagtttataatggttttgtcatttcgtctat |
17068276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 19338227 - 19338182
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
19338227 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
19338182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 20164122 - 20164077
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
20164122 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
20164077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 25820999 - 25820954
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
25820999 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
25820954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 26856871 - 26856916
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||| || |||||||||||||| ||||||||||||| ||||| |
|
|
| T |
26856871 |
tccacttaagtatgtgagtttataattactttgtcatttcgtctat |
26856916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 30455269 - 30455314
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
30455269 |
tccacttgtgtatgtgagtttataatgactttgccatttcgtctat |
30455314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 32533906 - 32533951
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32533906 |
tccacttatgtgtgtgagtttataatagttttgtcatttcgtctat |
32533951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 32880628 - 32880591
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatt |
57 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
32880628 |
tccacttgtgtgtgtgagtttataatggctttgtcatt |
32880591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 35758354 - 35758399
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
35758354 |
tccacttatgtgtgtgagtttataatggctttaccatttcgtctat |
35758399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 36018957 - 36019002
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
36018957 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
36019002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 39606484 - 39606529
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
39606484 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
39606529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 40958623 - 40958578
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
40958623 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
40958578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 43839407 - 43839452
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||| ||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
43839407 |
tccacatatatgtgtgagtttatagtgactttgtcatttcatctat |
43839452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 45191609 - 45191564
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
45191609 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
45191564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 45566750 - 45566713
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
45566750 |
tgtgtgtgagtttataatgactttgccatttcgtctat |
45566713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 45788702 - 45788747
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||| ||||||| ||||| |
|
|
| T |
45788702 |
tccacttctgtgtgtgagtttataatggctttatcatttcgtctat |
45788747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 49500940 - 49500985
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
49500940 |
tccacttgtgtgtgtgagtttataatagctttgtcatttcgtctat |
49500985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 49632634 - 49632679
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| ||||||| ||||| |
|
|
| T |
49632634 |
tccacttgtgtgtgtgagtttataatgattttatcatttcgtctat |
49632679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 50248108 - 50248153
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
50248108 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
50248153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 22 - 58
Target Start/End: Original strand, 7286616 - 7286652
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
7286616 |
cacttatgtgtgtgagtttataatggctttgttattt |
7286652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 22 - 66
Target Start/End: Complemental strand, 16084280 - 16084237
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| |||||| |
|
|
| T |
16084280 |
cacttatgtgtgtgagtt-ataatgtctttgtcatttcgtctatt |
16084237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 59
Target Start/End: Original strand, 16689168 - 16689204
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
16689168 |
acttgtgtgtgtgagtttataatggctttgtcatttc |
16689204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 52
Target Start/End: Complemental strand, 39787699 - 39787667
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttg |
52 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
39787699 |
tccacttatatgtgtgagtttataatgactttg |
39787667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 65
Target Start/End: Original strand, 41651158 - 41651198
Alignment:
| Q |
25 |
ttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
41651158 |
ttatgtgtgtgagtttataatggttttgtcatttcgtctat |
41651198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 48302363 - 48302410
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttata--atgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||| ||||| |
|
|
| T |
48302363 |
tccacttatgtgtgtgagtttataatatggctttgtcatttcgtctat |
48302410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 28 - 56
Target Start/End: Original strand, 50905522 - 50905550
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50905522 |
tgtgtgtgagtttataatgactttgtcat |
50905550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 64362 - 64407
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
64362 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
64407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 195820 - 195865
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
195820 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
195865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 82)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 1277517 - 1277562
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1277517 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
1277562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 59
Target Start/End: Complemental strand, 19867328 - 19867291
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19867328 |
cacttatgtgtgtgagtttataatgactttgtcatttc |
19867291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 40596035 - 40596080
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40596035 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
40596080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 43070733 - 43070688
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
43070733 |
tccacttatgtgtgtgagtttataatgactttgccatttcgtctat |
43070688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 17 - 65
Target Start/End: Original strand, 21067513 - 21067561
Alignment:
| Q |
17 |
tcatccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
21067513 |
tcatccacttgtgtgtgtgagtttataataactttgtcatttcgtctat |
21067561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 26310795 - 26310752
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26310795 |
cacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
26310752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 27389738 - 27389777
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27389738 |
tccacttatgtgtgtgagtttataatgactttgttatttc |
27389777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 65
Target Start/End: Original strand, 28489265 - 28489308
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
28489265 |
cacttatgtgtgtgagtttataatgactttgccatttcgtctat |
28489308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 972640 - 972598
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
972640 |
acttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
972598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 2025730 - 2025686
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
2025730 |
tccacttatgtgtgtgagtttataatgac-ttgtcatttcatctat |
2025686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 4429990 - 4429945
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||| ||||| |
|
|
| T |
4429990 |
tccacttatgtgtgtgagtttataataactttatcatttcgtctat |
4429945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 9054020 - 9053975
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
9054020 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
9053975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 9068890 - 9068927
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9068890 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
9068927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 9640583 - 9640538
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
9640583 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
9640538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 10393551 - 10393506
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
10393551 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
10393506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 17080544 - 17080589
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||| ||||| |
|
|
| T |
17080544 |
tccacttatgtgtgtgaatttataatgattttgtcatttcgtctat |
17080589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 18115172 - 18115217
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
18115172 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
18115217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 19836136 - 19836091
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19836136 |
tccacttgtgcgtgtgagtttataatgactttgtcatttcgtctat |
19836091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 23219155 - 23219118
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23219155 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
23219118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 23311222 - 23311177
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
23311222 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
23311177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 24051482 - 24051527
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
24051482 |
tccacttgtgtatgtgagtttataatgactttgtcatttcgtctat |
24051527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 27004004 - 27003967
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27004004 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
27003967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 27389976 - 27389931
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
27389976 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
27389931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 32274019 - 32273982
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32274019 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
32273982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 34856660 - 34856705
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
34856660 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
34856705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 22 - 59
Target Start/End: Original strand, 35232624 - 35232661
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35232624 |
cacttgtgtgtgtgagtttataatgactttgtcatttc |
35232661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 35933026 - 35932981
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
35933026 |
tccacttatgtgtgtgagtttataatgattttgccatttcgtctat |
35932981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 36246043 - 36245998
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
36246043 |
tccacttgtgtgtgtgagtttataatgactttgacatttcgtctat |
36245998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 37191323 - 37191368
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
37191323 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
37191368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 38975787 - 38975742
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
38975787 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
38975742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 39916542 - 39916587
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
39916542 |
tccacttgtgtgtgtgagtttataatgactttatcatttcgtctat |
39916587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 4444913 - 4444870
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
4444913 |
cacttgtgtgtgtgagtttataatgcctttgtcatttcgtctat |
4444870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 65
Target Start/End: Original strand, 24638035 - 24638078
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
24638035 |
cacttgtgtgtgtgagtttataatgactttatcatttcgtctat |
24638078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 40292649 - 40292688
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
40292649 |
tccacttatgtgtgtgagtttataatgattttgccatttc |
40292688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 28 - 58
Target Start/End: Original strand, 5203640 - 5203670
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5203640 |
tgtgtgtgagtttataatgactttgtcattt |
5203670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 7809657 - 7809699
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
7809657 |
acttatgtgtgtgagtttataatggttttgtcatttcgtctat |
7809699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 28 - 58
Target Start/End: Complemental strand, 30269213 - 30269183
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30269213 |
tgtgtgtgagtttataatgactttgtcattt |
30269183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 66
Target Start/End: Original strand, 33028309 - 33028355
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
33028309 |
tccacttatgtgtgtgagtttataatggctttaccatttcgtctatt |
33028355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 36259876 - 36259914
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcattt |
58 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
36259876 |
tccacttatgtgtgtgagtttataatggctttgccattt |
36259914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 28 - 66
Target Start/End: Complemental strand, 40529380 - 40529342
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
40529380 |
tgtgtgtgagtttataatggctttgtcatttcatctatt |
40529342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 671100 - 671063
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
671100 |
tgtgtgtgagtttataatgactttgccatttcgtctat |
671063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 1833368 - 1833323
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
1833368 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
1833323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 4165038 - 4165083
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4165038 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
4165083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 6029691 - 6029736
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
6029691 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
6029736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 7179350 - 7179305
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
7179350 |
tccacttatgtgtgtgagtttataatagttttgtcatttcgtctat |
7179305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Complemental strand, 9362540 - 9362503
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
9362540 |
tgtgtgtgagtttataatgactttgtcgtttcgtctat |
9362503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 10165611 - 10165656
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
10165611 |
tccacttgtgtgtgtgagtttataatgactttgctatttcgtctat |
10165656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 14126982 - 14127027
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
14126982 |
tccacttgtgtgtgcgagtttataatggctttgtcatttcgtctat |
14127027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 16496679 - 16496724
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
16496679 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
16496724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 17869173 - 17869128
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| |||||| ||||| |
|
|
| T |
17869173 |
tccacttatgtgtgtgaatttataatggctttgccatttcgtctat |
17869128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 17986103 - 17986058
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
17986103 |
tccacttgtgtgtgtgagtttataatagctttgtcatttcgtctat |
17986058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 20695532 - 20695487
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
20695532 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
20695487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 23074693 - 23074648
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
23074693 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
23074648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 24443916 - 24443871
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
24443916 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
24443871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 24652363 - 24652318
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
24652363 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
24652318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 25328353 - 25328308
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
25328353 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
25328308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 26802413 - 26802458
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
26802413 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
26802458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 26809963 - 26810008
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
26809963 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
26810008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 26824990 - 26825035
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
26824990 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
26825035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 28870029 - 28870074
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
28870029 |
tccacttgtgtgtgtgagtttataatggttttgtcatttcgtctat |
28870074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 29119685 - 29119730
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
29119685 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
29119730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 29402097 - 29402134
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
29402097 |
tgtgtgtgagtttataatgattttgtcatttcgtctat |
29402134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 29622283 - 29622328
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| ||||| |
|
|
| T |
29622283 |
tccacttatgtgtgtgagtttataatggctttgctatttcgtctat |
29622328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 34930304 - 34930349
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
34930304 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
34930349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 36136911 - 36136866
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
36136911 |
tccacttgtgtgtgtgagtttataataattttgtcatttcgtctat |
36136866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 36319551 - 36319506
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||| ||||||||| |||||||||||| ||||| |
|
|
| T |
36319551 |
tccacttgtgtgtgtgaatttataatggctttgtcatttcgtctat |
36319506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 36569358 - 36569403
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
36569358 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
36569403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 36727066 - 36727111
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| | ||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
36727066 |
tccacttgtctgtgtgagtttataatgactttgccatttcgtctat |
36727111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 36790364 - 36790319
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
36790364 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
36790319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 36854207 - 36854162
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
36854207 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
36854162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 37067785 - 37067822
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
37067785 |
tgtgtgtgagtttataatgactttgccatttcgtctat |
37067822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 37940997 - 37941042
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
37940997 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
37941042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 39150975 - 39150930
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
39150975 |
tccacttgtgtgtgtgagtttataatggctttgacatttcgtctat |
39150930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 39955772 - 39955817
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
39955772 |
tccacttgtgtgtgtgagtttataatgactttgccacttcgtctat |
39955817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 40044965 - 40044920
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
40044965 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
40044920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 40318834 - 40318789
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
40318834 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
40318789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 41071141 - 41071186
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
41071141 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
41071186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 42448290 - 42448335
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
42448290 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
42448335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 43150207 - 43150162
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
43150207 |
tccacttgtgtgtgtgagtttataatgactttaccatttcgtctat |
43150162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 28 - 64
Target Start/End: Original strand, 6525927 - 6525963
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttcta |
64 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
6525927 |
tgtgtgtgagtttatgatgactttgtcatctcttcta |
6525963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 65
Target Start/End: Original strand, 37320333 - 37320373
Alignment:
| Q |
25 |
ttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
37320333 |
ttatatgtgtgagtttataattattttgtcatttcttctat |
37320373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 42645514 - 42645467
Alignment:
| Q |
20 |
tccacttatgt--gtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| ||||| |
|
|
| T |
42645514 |
tccacttatgtatgtgtgagtttataatggctttgtcatttcgtctat |
42645467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 52)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 43461383 - 43461338
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43461383 |
tccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
43461338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 15488829 - 15488873
Alignment:
| Q |
21 |
ccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15488829 |
ccacttgtgtgtgtgagtttataatgactttgtcatttcgtctat |
15488873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 33898309 - 33898348
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33898309 |
tccacttgtgtgtgtgagtttataatgactttgtcatttc |
33898348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 8859336 - 8859290
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
8859336 |
tccacttgtgtgtgtcagtttataatgactttgtcatttcgtctatt |
8859290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 41164694 - 41164652
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
41164694 |
acttatgtgtgtgagtttataatggctttgtcatttcatctat |
41164652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 43841761 - 43841715
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctatt |
66 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
43841761 |
tccacttgtgtgtgtgagtttataatgactttctcatttcgtctatt |
43841715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 8293604 - 8293559
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||| ||||| |
|
|
| T |
8293604 |
tccacttatgtgtgtgaatttataatggctttgtcatttcgtctat |
8293559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 10202249 - 10202294
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
10202249 |
tccacttatatgtgtgagtttataatggctttgtcatttcgtctat |
10202294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 18055946 - 18055983
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18055946 |
tgtgtgtgagtttataatgactttgtcatttcgtctat |
18055983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 18999408 - 18999453
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
18999408 |
tccacttgtgtgtgtgagtttattatgactttgtcatttcgtctat |
18999453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 19967813 - 19967858
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19967813 |
tccacttgcgtgtgtgagtttataatgactttgtcatttcgtctat |
19967858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 23497561 - 23497516
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
23497561 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
23497516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 23957131 - 23957176
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
23957131 |
tccacttatgtgtgtgagtttttaatggctttgtcatttcgtctat |
23957176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 22 - 59
Target Start/End: Complemental strand, 29741005 - 29740968
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29741005 |
cacttatgtgtgtgagtttacaatgactttgtcatttc |
29740968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 30413256 - 30413301
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
30413256 |
tccacttatgtgtaagagtttataatgactttgtcatttcgtctat |
30413301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 31525001 - 31524956
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
31525001 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
31524956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 31819717 - 31819762
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
31819717 |
tccacttatgtgtgtgagtttataatagctttgtcatttcgtctat |
31819762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 35687836 - 35687791
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
35687836 |
tccacttatgtgtataagtttataatgactttgtcatttcgtctat |
35687791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 36685452 - 36685407
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
36685452 |
tccacttgtgtgtgtgagtttataataactttgtcatttcgtctat |
36685407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 433217 - 433261
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttcta |
64 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
433217 |
tccacttgtgtgtgtgagtttataatggctttgtcatttcgtcta |
433261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 6731619 - 6731666
Alignment:
| Q |
18 |
catccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
6731619 |
catccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
6731666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 12541383 - 12541340
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
12541383 |
cacttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
12541340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 19593602 - 19593641
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttc |
59 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
19593602 |
tccacttatgtgtgtgagtttataatggctttgccatttc |
19593641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 65
Target Start/End: Original strand, 40812098 - 40812141
Alignment:
| Q |
22 |
cacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
40812098 |
cacttatgtgtgtgagtttataatggctttgccatttcgtctat |
40812141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 16010659 - 16010617
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
16010659 |
acttgtgtgtgtgagtttataatggctttgtcatttcgtctat |
16010617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 18779990 - 18780036
Alignment:
| Q |
20 |
tccacttatgtgtgtgag-tttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
18779990 |
tccacttatgtgtgtgagttttataatgactttgccatttcgtctat |
18780036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 35706934 - 35706976
Alignment:
| Q |
23 |
acttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||| ||||| |
|
|
| T |
35706934 |
acttatgtgtgtgagtttataatgactttgccgtttcgtctat |
35706976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 727338 - 727293
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
727338 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
727293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 2476994 - 2476949
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| || ||||||||| ||||| |
|
|
| T |
2476994 |
tccacttgtgtgtgtgagtttataatggctatgtcatttcgtctat |
2476949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 3048621 - 3048666
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| ||||||| ||||| |
|
|
| T |
3048621 |
tccacttatgtgtgtgagtttttaatggctttatcatttcgtctat |
3048666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 4014862 - 4014817
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
4014862 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
4014817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 5887647 - 5887692
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||| ||||||||||||||||| |||| ||||||| ||||| |
|
|
| T |
5887647 |
tccacttatatgtgtgagtttataatggctttatcatttcgtctat |
5887692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 8532185 - 8532222
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatt |
57 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
8532185 |
tccacttgtgtgtgtgagtttataatgactttgccatt |
8532222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 11543848 - 11543803
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
11543848 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
11543803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 11816825 - 11816780
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||| ||||||||||| |||||||||||| ||||| |
|
|
| T |
11816825 |
tccacttgtgtgtgtaagtttataatggctttgtcatttcatctat |
11816780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 13268024 - 13267979
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
13268024 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
13267979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 15897293 - 15897338
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
15897293 |
tccacttgtgtgtgtgagtttataatgcctttgccatttcgtctat |
15897338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 20251534 - 20251489
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
20251534 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
20251489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 21840498 - 21840453
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||| |||||||||||||| ||||| |||||||||||| |
|
|
| T |
21840498 |
tccacttgtgtgggtgagtttataatggctttgccatttcttctat |
21840453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 23840896 - 23840941
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
23840896 |
tccacttgtgtgtgtgagtttataatgactttgctatttcatctat |
23840941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 33607122 - 33607167
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
33607122 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
33607167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 34667123 - 34667168
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
34667123 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
34667168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 35476539 - 35476494
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
35476539 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
35476494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 35493740 - 35493785
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||| ||||||||| |||||||||||| ||||| |
|
|
| T |
35493740 |
tccacttgtgtgtgtgaatttataatggctttgtcatttcatctat |
35493785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 36216802 - 36216757
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
36216802 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
36216757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 36754790 - 36754745
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
36754790 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
36754745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 36755027 - 36755072
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
36755027 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
36755072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 36794883 - 36794928
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
36794883 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
36794928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 39070098 - 39070143
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
39070098 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
39070143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 39310445 - 39310490
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
39310445 |
tccacttgtgtgtgtgagtttataatagctttgtcatttcgtctat |
39310490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 44276342 - 44276387
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
44276342 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
44276387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 45049464 - 45049509
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
45049464 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
45049509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0882 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0882
Description:
Target: scaffold0882; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 3746 - 3701
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
3746 |
tccacttgtgtgtgtgagtttataatgactttgccatttcgtctat |
3701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0515 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0515
Description:
Target: scaffold0515; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 2557 - 2602
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
2557 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
2602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 2557 - 2602
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
2557 |
tccacttatgtgtgtgagtttataatggctttgccatttcgtctat |
2602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0795 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0795
Description:
Target: scaffold0795; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 1147 - 1184
Alignment:
| Q |
28 |
tgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
1147 |
tgtgtgtgagtttataatgactttgccatttcgtctat |
1184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0595 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0595
Description:
Target: scaffold0595; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 424 - 469
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
424 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0402 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0402
Description:
Target: scaffold0402; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 1290 - 1245
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
1290 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
1245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0287 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 1107 - 1062
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
1107 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
1062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0244 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0244
Description:
Target: scaffold0244; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 7806 - 7761
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
7806 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
7761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 90648 - 90693
Alignment:
| Q |
20 |
tccacttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
90648 |
tccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
90693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0633 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0633
Description:
Target: scaffold0633; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 65
Target Start/End: Complemental strand, 3838 - 3798
Alignment:
| Q |
25 |
ttatgtgtgtgagtttataatgactttgtcatttcttctat |
65 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
3838 |
ttatgtgtgtgagtttataatggttttgtcatttcgtctat |
3798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University