View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3686_low_29 (Length: 260)
Name: NF3686_low_29
Description: NF3686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3686_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 45668072 - 45668316
Alignment:
| Q |
1 |
acagaagaatctaccgcagatttgtactaatcaccttgatcctacatcggtaatcataatcattgataattgatttcaattttgtcaactagttagg-ag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45668072 |
acagaagaatctaccgcagatttgtactaatcaccttgatcctacatcggtaatcataatcattgataattgatttcaattttgtcaactagttagggag |
45668171 |
T |
|
| Q |
100 |
tcttagtttcattcgaaagaacagaaaatagatatctctgctaatgcttgcttataacttgaactttcagtgactggttttattactcctttttcagtgt |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668172 |
tcttagtttcattcaaaagaacagaaaatagatctctctgctaatgcttgcttataacttgaactttcagtgactggttttattactcctttttcagtgt |
45668271 |
T |
|
| Q |
200 |
ttcttccctcagaatttgattgtcagtgttagaacaccacttttt |
244 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45668272 |
ttcttccctcagaatttgattgccagtgttagaacaccacttttt |
45668316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University