View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3686_low_33 (Length: 248)
Name: NF3686_low_33
Description: NF3686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3686_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 78 - 239
Target Start/End: Complemental strand, 32905559 - 32905395
Alignment:
| Q |
78 |
aagtttccttcatcaaagaaaatcttatttgagacatatcacatattaaat--gagtgtcttttnnnnnnntattaaatatgagtgagcatttcc-tcgg |
174 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||| ||| |
|
|
| T |
32905559 |
aagtttccttcatcagagaaaatcttatttgagacatatcacatattaaatatgagtgtcttttaaaaaaatattaaatatgaatgagcatttctatcga |
32905460 |
T |
 |
| Q |
175 |
ttgaaatttgaatattgattcactatattatggaagtttagtcaattatgctaaactcaaccttt |
239 |
Q |
| |
|
||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
32905459 |
ttgaaatttgaatattgattcactacattatgaaaatttagtcaattatgctaaactcaaccttt |
32905395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 32906017 - 32905939
Alignment:
| Q |
1 |
catggtggaagaatgtaagagcggactgataagaaaatcataaattcgaactcaacttttaacataaaaatactaacaa |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
32906017 |
catggtggaagaatgtaagagcggactgataagaaaatcataaattcgaactcaactttcaacataaaaacactaacaa |
32905939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University