View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3686_low_38 (Length: 235)
Name: NF3686_low_38
Description: NF3686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3686_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 40929322 - 40929117
Alignment:
| Q |
19 |
gataatgcctatgtttgatgaaaatggtctttgtttgatggcagtacagttagttatatttgtcataatcgcagagttggcagtgtgattatgtcgagtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40929322 |
gataatgcctatgtttgatgaaaatggtctttgtttgatggcagtacagttagttatatttgtcataatcgcagagttggcagtgtgattatgtcgagtt |
40929223 |
T |
 |
| Q |
119 |
atgtatttaatcgatgttataatattttgccttcttaaccaactggcctttcctgctgagtggctgcataaattgcattgttggcattgttattctacac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40929222 |
atgtatttaatcgatgttataatattttgccttcttaaccaactggcctttcctgctgagtggctgcataaattgcattgttggcattgttattctacac |
40929123 |
T |
 |
| Q |
219 |
aggttc |
224 |
Q |
| |
|
||||| |
|
|
| T |
40929122 |
cggttc |
40929117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University