View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3686_low_43 (Length: 202)
Name: NF3686_low_43
Description: NF3686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3686_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 106 - 200
Target Start/End: Complemental strand, 11646453 - 11646359
Alignment:
| Q |
106 |
tgcaagttattcaacttaacttgttatttaaggaactcaaaaaagagacgatgtttattcaaattcagtgcataccacagagacttgagagaact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11646453 |
tgcaagttattcaacttaacttgttatttaaggaactcaaaaaagagactatgtttattcaaattcagtgcatactacagagacttgagagaact |
11646359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University