View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_high_27 (Length: 348)
Name: NF3687_high_27
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 258 - 342
Target Start/End: Complemental strand, 4914932 - 4914848
Alignment:
| Q |
258 |
tctcaccgattagtattgtatatatgatccattctttgtcacatacgaagagaatatatggaacaaagtttactaatacagtaag |
342 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||| |||||| |
|
|
| T |
4914932 |
tctcaccagttagtactgtatatatgatccattctttgtcacataagaagataatatatagaacaaagtttactaatatagtaag |
4914848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University