View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_high_29 (Length: 346)
Name: NF3687_high_29
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 30923274 - 30923021
Alignment:
| Q |
1 |
ttgtgttttgtttcacctatgtttatgtcgaagtacaagcaaaggttgtttttatgtctggttttatttgcatggttgtacaatggaagtgtggctatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923274 |
ttgtgttttgtttcacctatgtttatgtcgaagtacaagcaaaggttgtttttatgtctggttttatttgcatggttgtacaatggaagtgtggctatgg |
30923175 |
T |
 |
| Q |
101 |
cggcttcaagtgaagacagtggaagttctaaagaccttgatcagacaccaacatgggctgttggttgtgtttgtactgttttcatcttggtttctataat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923174 |
cggcttcaagtgaagacagtggaagttctaaagaccttgataagacaccaacatgggctgttggttgtgtttgtactgttttcatcttggtttctataat |
30923075 |
T |
 |
| Q |
201 |
tcttgagaaaagtcttcacaaaattggaacggtatgaaaccaatttgaaacttc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923074 |
tcttgagaaaagtcttcacaaaattggaacggtatgaaaccaatttgaaacttc |
30923021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 136 - 235
Target Start/End: Original strand, 9925175 - 9925274
Alignment:
| Q |
136 |
cttgatcagacaccaacatgggctgttggttgtgtttgtactgttttcatcttggtttctataattcttgagaaaagtcttcacaaaattggaacggtat |
235 |
Q |
| |
|
|||||||| ||||||||||||| ||||| | ||||| || |||||||||||| | || ||| |||||||| |||||||||||| | |||||||||| |
|
|
| T |
9925175 |
cttgatcaaacaccaacatggggtgttgctgcagtttgcaccgttttcatcttgatatccatagcccttgagaagagtcttcacaaattaggaacggtat |
9925274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University