View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_high_68 (Length: 239)
Name: NF3687_high_68
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 12545403 - 12545170
Alignment:
| Q |
1 |
atatctttcatatgttgaaattctaacagatcatttcctactaagatatcattgtccacttaaatggccaaggcagtgaataatggatccttgtgcttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12545403 |
atatctttcatatgttgaaattctaacagatcatttcctacaaagatatcattgtccacttaaatggccaaggcagtgaataatggatccttgtgcttca |
12545304 |
T |
 |
| Q |
101 |
taaactatgagtgatctgaaagtttcctgattaaaaccatcagttaagagagttgaaataagcttctcatgtcattcc-------------cttttgcaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12545303 |
taaactatgagtgatctgaaagtttcctgattaaaaccatcagttaagagagttgaaataagcttctcatgtcattccctttgattatacccttttgcaa |
12545204 |
T |
 |
| Q |
188 |
cctatcttgcattatatctatctacagttccgta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12545203 |
cctatcttgcattatatctatctacagttccgta |
12545170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University