View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_high_69 (Length: 238)
Name: NF3687_high_69
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_high_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 129 - 221
Target Start/End: Original strand, 19712109 - 19712203
Alignment:
| Q |
129 |
gacggttattatgagacgaaagagagtaattgtttatttattaatctcacatataccatcc--atatatgtaataaatatctcaaaagtggatcc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19712109 |
gacggttattatgagacgaaagagagtaattgtttatttattaatctcacatataccatccatatatatgtaataaatatctcaaaagtggatcc |
19712203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 19711981 - 19712042
Alignment:
| Q |
1 |
cattgatatattttcattagcattatgtaaattagaaaatgacaatttagaagtgatgcatg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19711981 |
cattgatatattttcattagcattatgtaaattagaaaatgacaatttagaagtgatgcatg |
19712042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University