View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_high_76 (Length: 235)
Name: NF3687_high_76
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_high_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 9 - 122
Target Start/End: Complemental strand, 13094998 - 13094885
Alignment:
| Q |
9 |
tttagtgttataaattttgatgttggttacatgatcatatgttgtatctatatggatcattggctctgctatgtcaatatcttggtaggtaatttatgtg |
108 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||| |||| |||||| |||||||||||||||||||||||| |
|
|
| T |
13094998 |
tttagtgttataaatcttgatgttcgttacataatcatatgttgtatctatatggatcattaactctactatgttaatatcttggtaggtaatttatgtt |
13094899 |
T |
 |
| Q |
109 |
atgttgtgtaaata |
122 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
13094898 |
atgctgtgtaaata |
13094885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 13094881 - 13094834
Alignment:
| Q |
160 |
ctgtttagtaaactttgcaacttaactgttttgctttcttctttcttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13094881 |
ctgtttagtaaactttgcaacttaactgttttgctttattctttcttt |
13094834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University