View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_high_87 (Length: 216)
Name: NF3687_high_87
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_high_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 3 - 197
Target Start/End: Complemental strand, 34826369 - 34826175
Alignment:
| Q |
3 |
gtgacacggaatatgacaaggaatatgaagaatataggagttgaatttggagaaagttcatgcttgatagtagatggtttggagaatgttgtgaaagaga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826369 |
gtgacacggaatatgacaaggaatatgaagaatataggagttgaaattggagaaagttcatgcttgatagtagatggtttggagaatgttgtgaaagaga |
34826270 |
T |
 |
| Q |
103 |
aaatgaagggtagtggtcgtaaagaaaagaagaaattagaggaagagannnnnnngaacaagttagaggaagagattgttggtgatggtaaagag |
197 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826269 |
aaatgaagggtggtggtcgcaaaggaaagaagaaattagaggaagatatttttttgaacaagttagaggaagagattgttggtgatggtaaagag |
34826175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University