View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_low_35 (Length: 286)
Name: NF3687_low_35
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 11 - 267
Target Start/End: Complemental strand, 31103560 - 31103304
Alignment:
| Q |
11 |
caaagggctgaaatgcttgctgtgatttgttgcagggtctgttggtacgtgaatttgtccgtgttgacagacacttcataaatcattcttcaaaagatgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
31103560 |
caaagggctgaaatgcttgctgtgatttgtcgcagggtctgttggtacgtgaatttgtctgtgttgatggacacttcataaatcattcttcaaaagacgg |
31103461 |
T |
|
| Q |
111 |
tttgattactcagacttgtctctggttcgtttggtccatttaatggttgcaattttatacacatcaatttctttttacaatctaatttcaggtctcacgc |
210 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31103460 |
tttgattactcagacgtgtctttggttcgtttggtccatttaatggttgtaattttatacacatcaatttctttttacaatctaatttaaggtctcacgc |
31103361 |
T |
|
| Q |
211 |
tgagcttgctggtttgtacttatggtgtgtagttttctgcgatgcatctaggttcat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31103360 |
tgagcttgctggtttgtacttatggtgtgtagttttctgcgatgcatctaggttcat |
31103304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 76
Target Start/End: Complemental strand, 8119292 - 8119226
Alignment:
| Q |
12 |
aaagggctga-aatgcttgctgtgatttgttgcagggtctgttggtacgtgaat-ttgtccgtgttg |
76 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |||||||||| ||||| |||| ||||||| |
|
|
| T |
8119292 |
aaagggctgataatgcttgctgtgatatgttgcaggggctgttggtacatgaatcttgttcgtgttg |
8119226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 76
Target Start/End: Complemental strand, 30420230 - 30420174
Alignment:
| Q |
21 |
aaatgcttgctgtgatttgttgcagggtctgttggtacgtgaat-ttgtccgtgttg |
76 |
Q |
| |
|
||||||| || |||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
30420230 |
aaatgctcgcagtgatttgttgcaggggttgttggtacgtgaatcttgtccgtgttg |
30420174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 75
Target Start/End: Original strand, 22377419 - 22377472
Alignment:
| Q |
22 |
aatgcttgctgtgatttgttgcagggtctgttggtacgtgaat-ttgtccgtgtt |
75 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
22377419 |
aatgcttgctgtgatttgtcgcaggg-ctgttggtacatgaatcttgtccgtgtt |
22377472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 76
Target Start/End: Original strand, 29758290 - 29758356
Alignment:
| Q |
12 |
aaagggctgaaa-tgcttgctgtgatttgttgcagggtctgttggtacgtgaat-ttgtccgtgttg |
76 |
Q |
| |
|
|||||||||||| ||| ||||||| |||| |||||| |||||||||||||||| |||||||||||| |
|
|
| T |
29758290 |
aaagggctgaaaatgcgcgctgtgaattgtcgcaggggctgttggtacgtgaatcttgtccgtgttg |
29758356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University