View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_low_60 (Length: 247)
Name: NF3687_low_60
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 242
Target Start/End: Complemental strand, 6415269 - 6415035
Alignment:
| Q |
8 |
cacagattgtacatggatagaataaagcgccacaacatgagatatgctttaaaattccaaaactcacacgggcagctgtactaataactatgctagctgg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6415269 |
cacagattgtacatggatagaataaagcgccacaacatgcgatatgctttcaaattccaaaactcacacgggcagctgtactaataactatgctagctgg |
6415170 |
T |
 |
| Q |
108 |
gattcacttcatatttccttcaaattcacaacatcaatgtctttaacaatagtactattttttaaactattgtcacgtacataaattattactacattca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6415169 |
gattcacttcatatttccttcaaattcacaacatcaatgtctttaacaatagtactattttttaaactattgtcacgtacataaattattactacattca |
6415070 |
T |
 |
| Q |
208 |
agctgactatactgtttgtacattaattaattttg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6415069 |
agctgactatactgtttgtacattaattaattttg |
6415035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University