View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_low_73 (Length: 237)
Name: NF3687_low_73
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_low_73 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 43 - 213
Target Start/End: Original strand, 38244074 - 38244245
Alignment:
| Q |
43 |
ttatttcttttatacatccttcctatcaaaacccttcacgtcctt-gaaatcgaaaatgaactatttgagttcatcaatttttccagcactacattaatt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38244074 |
ttatttcttttatacatccttcctatcaaaacccttcacgtcctttgaaatcgaaaatgaactatttgagttcatcaatttttccagcactacattaatt |
38244173 |
T |
|
| Q |
142 |
tatgttacgtcaattgaaatttctcaccattaagacactaggagcatgtcgacggtaatatattaggtatga |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
38244174 |
tatgttatgtcaattgaaatttctcaccattaagatactaggagcatgtcgacagtaatatattagatatga |
38244245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 38242888 - 38242931
Alignment:
| Q |
8 |
atcattcttaaatactctcacttcatttttattctttatttctt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38242888 |
atcattcttaaatactctcacttcatttttattctttatttctt |
38242931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 4 - 107
Target Start/End: Original strand, 3285366 - 3285468
Alignment:
| Q |
4 |
gtcaatcattcttaaatactctcacttcatttttattctttatttcttttatacatccttcctatcaaaacccttcacgtccttgaaatcgaaaatgaac |
103 |
Q |
| |
|
|||||||||||| ||||||| |||||| ||||||||| | ||| |||| | |||||||||||||||||||| ||||| ||| ||||| |||||||||| |
|
|
| T |
3285366 |
gtcaatcattctaaaatactttcactttatttttatt-tctatatcttgtgtacatccttcctatcaaaacgtttcacatccaagaaattgaaaatgaac |
3285464 |
T |
|
| Q |
104 |
tatt |
107 |
Q |
| |
|
|||| |
|
|
| T |
3285465 |
tatt |
3285468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University