View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3687_low_78 (Length: 235)

Name: NF3687_low_78
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3687_low_78
NF3687_low_78
[»] chr8 (2 HSPs)
chr8 (9-122)||(13094885-13094998)
chr8 (160-207)||(13094834-13094881)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 9 - 122
Target Start/End: Complemental strand, 13094998 - 13094885
Alignment:
9 tttagtgttataaattttgatgttggttacatgatcatatgttgtatctatatggatcattggctctgctatgtcaatatcttggtaggtaatttatgtg 108  Q
    ||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||  |||| |||||| ||||||||||||||||||||||||     
13094998 tttagtgttataaatcttgatgttcgttacataatcatatgttgtatctatatggatcattaactctactatgttaatatcttggtaggtaatttatgtt 13094899  T
109 atgttgtgtaaata 122  Q
    ||| ||||||||||    
13094898 atgctgtgtaaata 13094885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 13094881 - 13094834
Alignment:
160 ctgtttagtaaactttgcaacttaactgttttgctttcttctttcttt 207  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||    
13094881 ctgtttagtaaactttgcaacttaactgttttgctttattctttcttt 13094834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University