View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_low_83 (Length: 231)
Name: NF3687_low_83
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_low_83 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 5 - 216
Target Start/End: Original strand, 11241663 - 11241874
Alignment:
| Q |
5 |
gttgagatggtaaccacagtgactgcagacaccttaaaatctatttctaacatgtcaaattccaacataaatccattcctgtatcataattactagtaat |
104 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
11241663 |
gttgagatggtaaccgcagtcactgtagacaccttaaaatctatttctaacatgtcaaattccaacataaatccattcctatatcataattaatagtaat |
11241762 |
T |
 |
| Q |
105 |
tttttgggtgatagttcttttacgagcatcttcaatgggcataatttaagtaactcattccggataatttatcttttaattagtgagtttcattgtgtca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11241763 |
tttttgggtgatagttcttttacgagcatcttcaatgggcataatttaagtaactcattccggataatttatcttttaattagtgagtttcattgtgcca |
11241862 |
T |
 |
| Q |
205 |
taccatatttat |
216 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11241863 |
taccatatttat |
11241874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University