View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_low_84 (Length: 229)
Name: NF3687_low_84
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_low_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 16 - 146
Target Start/End: Complemental strand, 227558 - 227433
Alignment:
| Q |
16 |
aatacttacatggaagctgttaaaaccatcttaggtacaaaatttatatatcatgtcatacaagatgaattttattttaattatggtgcatagatatatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
227558 |
aatacttacatggaagctgttaaaaccatcttaggtacaaaatttatatatcatgtcatacaagatca-----attttaattatggtgcataaatatatt |
227464 |
T |
 |
| Q |
116 |
tacatttctttttaggtggtgaaatgcattt |
146 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |
|
|
| T |
227463 |
tacatttctttttaggtggtaaaatgcattt |
227433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 16 - 146
Target Start/End: Original strand, 256745 - 256871
Alignment:
| Q |
16 |
aatacttacatggaagctgttaaaaccatcttaggtacaaaatttatatatcatgtcatacaagatgaattttattttaattatggtgcatagatatatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
256745 |
aatacttacatggaagctgttaaaaccatcttaggtacaaaatttatatatcatgtcatacaagatca-----attttaattatggtgcataaatatatt |
256839 |
T |
 |
| Q |
116 |
tacatttcttttt-aggtggtgaaatgcattt |
146 |
Q |
| |
|
||||||||||||| ||||||| |||||||||| |
|
|
| T |
256840 |
tacatttctttttaaggtggtaaaatgcattt |
256871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 172 - 211
Target Start/End: Complemental strand, 226983 - 226944
Alignment:
| Q |
172 |
attttcacaagttatcatggctctcaattgtagcagcaac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226983 |
attttcacaagttatcatggctctcaattgtagcagcaac |
226944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 209
Target Start/End: Original strand, 257323 - 257360
Alignment:
| Q |
172 |
attttcacaagttatcatggctctcaattgtagcagca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
257323 |
attttcacaagttatcatggctctcaatcatagcagca |
257360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University