View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3687_low_85 (Length: 227)
Name: NF3687_low_85
Description: NF3687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3687_low_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 55286828 - 55286626
Alignment:
| Q |
14 |
cataggcacagacatcagacgcatactaacactgacacgttgaaaccagtaattatttcgaaaattgatataattgaatgtgatcacatgtgttggtcag |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55286828 |
catagacacagacatcagacgcatactaacactgacaccttgaaaccagtaattatttcgaaaattgacataattgaatgtgatcacatgtgttggtcag |
55286729 |
T |
 |
| Q |
114 |
tgtcgtgttggtgttggatattgacatgtgtcaaacatcgtacacgttttctaccagaagtattgatgatagagagattttaaatatagtaatatgtgat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
55286728 |
tgtcgtgttggtgttggatattgacatgtgtcaaacatcgtacacgctttctaccagaagtattgatgctagagagattttaaatatagtaatatgtaat |
55286629 |
T |
 |
| Q |
214 |
gat |
216 |
Q |
| |
|
||| |
|
|
| T |
55286628 |
gat |
55286626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University