View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3688_high_9 (Length: 285)
Name: NF3688_high_9
Description: NF3688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3688_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 32118328 - 32118079
Alignment:
| Q |
1 |
atttttactacgagtaaggctaaaaacttactaggttggcatcattctccgtccatgttaacaatgactgttgtcacttagaagagtgatgggaactagt |
100 |
Q |
| |
|
||||||| || |||||||||||||||||||| ||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32118328 |
atttttaataggagtaaggctaaaaacttacaaggttagcgtcattctccatccatgttaacaatgactgttgtcacttagaagagtgataggaactagt |
32118229 |
T |
 |
| Q |
101 |
tgcatgcttttaactctttcatgnnnnnnngttctcaaacaaaattgttgagatcaatataaacagtaccttataataggattatatgtttgcttgatgt |
200 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32118228 |
tgcatgcttttaactatttcatg-ttttttgttgacaaacaaaattgttgagatcattataaacagtaccttataaaaggattatatgtttgcttgatgt |
32118130 |
T |
 |
| Q |
201 |
ttttcttgtgagagtagtaatcctagcattgttaaattgttgcaaaagagc |
251 |
Q |
| |
|
|||||||| ||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
32118129 |
ttttcttgcaagagtagtagtcccagcatatttaaattgttgcaaaagagc |
32118079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University