View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3688_low_9 (Length: 289)
Name: NF3688_low_9
Description: NF3688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3688_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 7 - 266
Target Start/End: Complemental strand, 28019685 - 28019426
Alignment:
| Q |
7 |
gcagcagagaaaatcaacaacacaaaccaaatcactgaaaccaatcatcagcagcaggaagaacaaacttgttttccctgcaagacttttgttcagaaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28019685 |
gcagcagagaaaatcaacaacacaaaccaaatcactgaaaccaatcatcagcagcaggaagaacaaacttgttttccctgcaagacttttgttcagaaat |
28019586 |
T |
|
| Q |
107 |
gtgataattttgtaaagaatcagagggcaaagttctacatttttcgccgttgcattatgatgcttctgtgttggaatgagagcagctcggactgaactca |
206 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
28019585 |
gtgatcattttgtaaagaatcagagggcaaagttctacatttttcgccgttgcattatgttgcttctgtgttggaatgagagcagctcggactgaaatta |
28019486 |
T |
|
| Q |
207 |
gggaagggaaagagaagggagcaactttattcacatagcaattggtcaattacaaaaatg |
266 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28019485 |
gggaagggaaagggaagggagcaactttattcacatagcaattggtcaattacaaaaatg |
28019426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University