View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3689_high_7 (Length: 236)
Name: NF3689_high_7
Description: NF3689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3689_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 100 - 185
Target Start/End: Complemental strand, 39585448 - 39585370
Alignment:
| Q |
100 |
tgagtgagtatattggacatgatttgaattttgttttgcttgtaaaaatagaaaatagaaataatttttgagttgtggtttgttgt |
185 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
39585448 |
tgagtgagtatattggatatgatttgaattttgttttgcttgtaaaaata-------gaaatgatttttgagttgtggtttgttgt |
39585370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 178 - 220
Target Start/End: Complemental strand, 39584854 - 39584812
Alignment:
| Q |
178 |
tttgttgtatgtgtccaattgtcgggacatggaccccaacttt |
220 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39584854 |
tttgttgtatgtgtccgattgtcgggacatggaccccaacttt |
39584812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University