View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3689_high_7 (Length: 236)

Name: NF3689_high_7
Description: NF3689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3689_high_7
NF3689_high_7
[»] chr8 (2 HSPs)
chr8 (100-185)||(39585370-39585448)
chr8 (178-220)||(39584812-39584854)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 100 - 185
Target Start/End: Complemental strand, 39585448 - 39585370
Alignment:
100 tgagtgagtatattggacatgatttgaattttgttttgcttgtaaaaatagaaaatagaaataatttttgagttgtggtttgttgt 185  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||       ||||| |||||||||||||||||||||||    
39585448 tgagtgagtatattggatatgatttgaattttgttttgcttgtaaaaata-------gaaatgatttttgagttgtggtttgttgt 39585370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 178 - 220
Target Start/End: Complemental strand, 39584854 - 39584812
Alignment:
178 tttgttgtatgtgtccaattgtcgggacatggaccccaacttt 220  Q
    |||||||||||||||| ||||||||||||||||||||||||||    
39584854 tttgttgtatgtgtccgattgtcgggacatggaccccaacttt 39584812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University