View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3689_low_1 (Length: 560)
Name: NF3689_low_1
Description: NF3689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3689_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 134 - 358
Target Start/End: Original strand, 52595486 - 52595711
Alignment:
| Q |
134 |
gccgttagtttaaaatttgaatggagaattgaatggcagagacgttattagtacaagaatatcggg-tattttgaaggaagcgtactgaaagttaaagat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||| |
|
|
| T |
52595486 |
gccgttagtttaaaatttgaatggagaattgaatggcagagacgttattagtacaagaatatcggggtattttgaaggaagagtcctgaaagttaaagat |
52595585 |
T |
|
| Q |
233 |
gaaacggacccacttgatgacttggcttgacgaatttagaactactctgcttcattcaagcttccaccgttttctgcacccaacagttacattacaacac |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52595586 |
gaaacggacccacttgatgacttggcttgacgaatttagaactactctgcttcattcaagcttccaccgttttctgcacccaacagttacattacaacac |
52595685 |
T |
|
| Q |
333 |
ccactcattctctgttttcgtgccac |
358 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52595686 |
tcactcattctctgttttcgtgccac |
52595711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 513 - 554
Target Start/End: Original strand, 52595867 - 52595908
Alignment:
| Q |
513 |
gtgaaatgcatggtttgttatcattctgaaatcctttgcttc |
554 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
52595867 |
gtgaaatgcatggtttgttatctttctgaaatccattgcttc |
52595908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University