View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3689_low_4 (Length: 283)
Name: NF3689_low_4
Description: NF3689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3689_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 13 - 270
Target Start/End: Original strand, 24312138 - 24312395
Alignment:
| Q |
13 |
gcttcaactctaaatataaagtgcgtatcttcacttaaggaggcattagttcattatattacaaaattagcaaatgaaaatcatggtgaaaaaattgctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24312138 |
gcttcaactctaaatataaagtgcgtatcttcacttaaggagacattagttcattatattacaaaattagcaaatgaaaatcatggtgaaaaaattgctt |
24312237 |
T |
 |
| Q |
113 |
gcatcatctatgatggatttttatccttcatcgattctttggctaaggaactaaagctaccaagcatagtcttccgaaccactagtgctactaatttact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24312238 |
gcatcatctatgatggatttttatccttcatcgattctttggctaaggaactaaagctaccaagcatagtcttccgaaccactagtgctactaatttact |
24312337 |
T |
 |
| Q |
213 |
cacttatcacgtgtgtcttcagctacaaagcaaaggttaccttccattgcaaggttct |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24312338 |
cacttatcacgtgtgtcttcagctacaaagcaaaggttaccttccattgcaaggttct |
24312395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University