View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3691_high_12 (Length: 236)
Name: NF3691_high_12
Description: NF3691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3691_high_12 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 98 - 236
Target Start/End: Complemental strand, 19507325 - 19507187
Alignment:
| Q |
98 |
tgtaaaattcatctctaattttcttatcactaaattttatcttgtttaacttacacgccattgaagaacacatagggcctgtaaagttcaaccaaacgca |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19507325 |
tgtaaaattcatctctaattttcttgtcactaaattttatcttgtttaacttacacgccattgaagaaaacatagggcctgtaaagttcaaccaaacgca |
19507226 |
T |
 |
| Q |
198 |
tcacagtatggaccttcctgctgatatcaaaacatgtac |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19507225 |
tcacagtatggaccttcctgctgatatcaaaacatgtac |
19507187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 19507367 - 19507325
Alignment:
| Q |
15 |
atcaatgatataatatcttttgctaattagtatattagctagt |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19507367 |
atcaatgatatattatcttttgctaattagtatattagctagt |
19507325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University