View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3691_low_11 (Length: 251)
Name: NF3691_low_11
Description: NF3691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3691_low_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 13287499 - 13287752
Alignment:
| Q |
1 |
tatccgtgctt-cataggtagtaagtaataggaacttgacctttttcatgcgaactccttggaggctaagctccagttgactctctaggtcttgtaggtt |
99 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
13287499 |
tatccgtgctttcataggtagtaagtaataggaacttgacctttttcatgcgaactccttgtaggctaagttccagctgactctctaggtcttgtaggtt |
13287598 |
T |
 |
| Q |
100 |
tctgatactcaaaccataaagctgttctcccatcaactgcctatgagctcaaaatgttagtgttctcatacatggagcttaatgaatagaaatattg--a |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| | |
|
|
| T |
13287599 |
tctgatactcaaaccataaagctgttctcccatcaattgcctatgagctcaaaatgttagtgctctcatacaaggagcttaatgaatagaaatattgaaa |
13287698 |
T |
 |
| Q |
198 |
aaaaatgctgaatgaattagttgaaggttgtacctatggttttcctgtagactt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
13287699 |
aaaaatgctgaatgaattagttgaaggttttacctatggttttcttgtagactt |
13287752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University