View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3691_low_12 (Length: 250)
Name: NF3691_low_12
Description: NF3691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3691_low_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 6 - 250
Target Start/End: Complemental strand, 37784718 - 37784474
Alignment:
| Q |
6 |
agaagcaaagggacataaaattcctattttattttcatgataattcacatattttaatgaacataatttcctgtttaataaatttcttgagcgtataatt |
105 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37784718 |
agaaccaaagagacataaaattcctattttattttcatgataattcacatattttaatgaacataatttcctgtttaataaatttcttgagcgtgcaatt |
37784619 |
T |
 |
| Q |
106 |
ttgttcaaatagcacatttcaaattttgataaaggtagaacaacgccgaagcctctataaccgttcaatttgggacaaacaagtttgatagagattggaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37784618 |
ttgttcaaatagcacatttcaaattttgataaaggtagaacaacgccgaagcctctataaccgttcaatttgggacaaacaagtttgatagagattggag |
37784519 |
T |
 |
| Q |
206 |
ttgctcaattcatttttcttccttaatcaaactacgaccgtcctt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37784518 |
ttgctcaattcatttttcttccttaatcaaactacgaccgtcctt |
37784474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University