View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3691_low_13 (Length: 250)
Name: NF3691_low_13
Description: NF3691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3691_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 26 - 237
Target Start/End: Complemental strand, 19506731 - 19506520
Alignment:
| Q |
26 |
gacaaagttttaataaaagccaagtgttgcatgaatggaaaaatataagtaaatgaggattagaaataacctttaatggaagcaagtaacgaatgtacat |
125 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506731 |
gacatagttttaataaaagtcaagtgttgcatgaatggaaaaatataagtaaatgaggattagaaataacctttaatggaagcaagtaacgaatgtacat |
19506632 |
T |
 |
| Q |
126 |
gtatctttggaagctattcatgttttccaatactgtaactttaccaactttgatggcttttccttccttgtcaaaacatggttttgccgtaaaatatctg |
225 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506631 |
gtatctttggaagctattcatattttccaataccgtaactttaccaactttgatggcttttccttccttgtcaaaacatggttttgccgtaaaatatctg |
19506532 |
T |
 |
| Q |
226 |
aagctgtagtct |
237 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
19506531 |
aagcagtagtct |
19506520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University