View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3691_low_17 (Length: 229)
Name: NF3691_low_17
Description: NF3691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3691_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 13 - 140
Target Start/End: Complemental strand, 31758751 - 31758624
Alignment:
| Q |
13 |
aagaatatacaagttggttttatttatgtctgcatttatattgaagaggaacactctccccacactcactctttccaatatttcataataaatattaatg |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31758751 |
aagaaaatacaagttggttttatttatgtctgcatttatattgaagagaaacactctccccatactcactctttccaatatttcataataaatattaatg |
31758652 |
T |
|
| Q |
113 |
caatatcctaataataattggtactact |
140 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31758651 |
caatatcctaataataattggtactact |
31758624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 140 - 212
Target Start/End: Complemental strand, 31758480 - 31758408
Alignment:
| Q |
140 |
tatcttataatatggtccaaaatacttttgtttttgatgaagtggtattaaaagagtgcaagttggttttatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31758480 |
tatcttataatatggtccaaaatacttttgtttttgacgaagtggtattaaaagagtgcaagttggttttatt |
31758408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University