View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3693_high_46 (Length: 265)

Name: NF3693_high_46
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3693_high_46
NF3693_high_46
[»] chr7 (1 HSPs)
chr7 (149-183)||(42629065-42629099)


Alignment Details
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 149 - 183
Target Start/End: Original strand, 42629065 - 42629099
Alignment:
149 atgtatgtaatttaagtacaatattataattttta 183  Q
    |||||||||||||||||||||||||||||||||||    
42629065 atgtatgtaatttaagtacaatattataattttta 42629099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University