View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_high_52 (Length: 249)
Name: NF3693_high_52
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_high_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 35474359 - 35474594
Alignment:
| Q |
1 |
ccttatcagactcaacacattaattcttctacataccaagataatgacacaccacaaatgcataatcttggtacctttatgacaccattattccctcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35474359 |
ccttatcagactcaacacattaattcttctacataccaagataatgacacaccacaaatgcataatcttggtacctttatgacaccattattccctcaat |
35474458 |
T |
|
| Q |
101 |
ttgtctttggctttggcagctcagaaaattcacatcatatggttggaaatagtagctctaggtggagaaggcaagagatgttggcaaacaaatcattgaa |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35474459 |
ttgtctttggctttggcaactcagaaaattcacatcatatggttggaaatagtagctctaggtggagaaggcaagagatgttggcaaacaaatcattgaa |
35474558 |
T |
|
| Q |
201 |
cagaatatccttttttctctttttatgctttgtcct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35474559 |
cagaatatccttttttctctttttatgctttctcct |
35474594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 182 - 234
Target Start/End: Original strand, 35467740 - 35467792
Alignment:
| Q |
182 |
tggcaaacaaatcattgaacagaatatccttttttctctttttatgctttgtc |
234 |
Q |
| |
|
||||||||||||||||||||| ||| || |||||| ||||||||||||||||| |
|
|
| T |
35467740 |
tggcaaacaaatcattgaacaaaatttctttttttttctttttatgctttgtc |
35467792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University