View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3693_high_59 (Length: 238)

Name: NF3693_high_59
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3693_high_59
NF3693_high_59
[»] chr1 (1 HSPs)
chr1 (65-141)||(34264002-34264078)
[»] chr4 (1 HSPs)
chr4 (82-139)||(53225455-53225512)
[»] scaffold0066 (1 HSPs)
scaffold0066 (167-224)||(41798-41855)
[»] chr6 (1 HSPs)
chr6 (167-224)||(11441057-11441114)


Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 65 - 141
Target Start/End: Complemental strand, 34264078 - 34264002
Alignment:
65 gaagaatgttgaattataaatatgaagagcaattggaatttgattcaattgtaaaaatgtggatgtgaatgaattga 141  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
34264078 gaagaattttgaattataaatatgaagagcaattggaatttgattcaattgtaaaaatatggatgtgaatgaattga 34264002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 82 - 139
Target Start/End: Complemental strand, 53225512 - 53225455
Alignment:
82 aaatatgaagagcaattggaatttgattcaattgtaaaaatgtggatgtgaatgaatt 139  Q
    |||||||||||||||||||||||||||||||||| |||||| ||||||  ||||||||    
53225512 aaatatgaagagcaattggaatttgattcaattgaaaaaatatggatgcaaatgaatt 53225455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0066 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0066
Description:

Target: scaffold0066; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 224
Target Start/End: Complemental strand, 41855 - 41798
Alignment:
167 ttaaaattcagactagtcatcaactcgatcaatgtactaagttcttgatcgaataact 224  Q
    |||||| ||||||||||  |||||||||||||||||||| ||  ||||||||| ||||    
41855 ttaaaaatcagactagttttcaactcgatcaatgtactaggtcattgatcgaacaact 41798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 224
Target Start/End: Complemental strand, 11441114 - 11441057
Alignment:
167 ttaaaattcagactagtcatcaactcgatcaatgtactaagttcttgatcgaataact 224  Q
    |||||| ||||||||||  |||||||||||||||||||| ||  ||||||||| ||||    
11441114 ttaaaaatcagactagttttcaactcgatcaatgtactaggtcattgatcgaacaact 11441057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University