View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_high_64 (Length: 230)
Name: NF3693_high_64
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_high_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 211
Target Start/End: Complemental strand, 2398622 - 2398425
Alignment:
| Q |
14 |
catagggaggaggtagtacagtaataataaggatcaaatggttaattttgaccaacatgtttttaggtgaccatgtgttatgttttttccctcacatttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2398622 |
catagggaggaggtagtacagtaataataaggatcaaatggttaattttgaccaacatgtttttaggtgaccatgtgtgatgttttttccctcacatttc |
2398523 |
T |
|
| Q |
114 |
aactatagttaccacactttaattaatttcatatgcaaagtacggcatgtgtaggtaaccgatactgacatagtggatgcatgcaggtaccagcttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2398522 |
aactatagttaccacactttaattaatttcatatgcaaagtacggcatgtgtaggtaaccgatactgacatagtggatgcatgcaggtaccagcttct |
2398425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University