View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3693_high_67 (Length: 212)

Name: NF3693_high_67
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3693_high_67
NF3693_high_67
[»] chr4 (1 HSPs)
chr4 (62-188)||(49394684-49394810)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 62 - 188
Target Start/End: Complemental strand, 49394810 - 49394684
Alignment:
62 aacctagaaatccgaaccagtttctcactctagtttcttcattcacacgcttttcatcggaaccatccattctctgttttgagggttccaaactttttca 161  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49394810 aacccagaaatccgaaccagtttctcactctagtttcttcattcacacgcttttcatcggaaccatccattctctgttttgagggttccaaactttttca 49394711  T
162 gattgttccatttttacccttcgtttc 188  Q
    |||||||||||||||||||||||||||    
49394710 gattgttccatttttacccttcgtttc 49394684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University