View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_high_67 (Length: 212)
Name: NF3693_high_67
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_high_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 62 - 188
Target Start/End: Complemental strand, 49394810 - 49394684
Alignment:
| Q |
62 |
aacctagaaatccgaaccagtttctcactctagtttcttcattcacacgcttttcatcggaaccatccattctctgttttgagggttccaaactttttca |
161 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49394810 |
aacccagaaatccgaaccagtttctcactctagtttcttcattcacacgcttttcatcggaaccatccattctctgttttgagggttccaaactttttca |
49394711 |
T |
 |
| Q |
162 |
gattgttccatttttacccttcgtttc |
188 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
49394710 |
gattgttccatttttacccttcgtttc |
49394684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University