View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_14 (Length: 464)
Name: NF3693_low_14
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_14 |
 | |
|
| [»] scaffold0219 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0219 (Bit Score: 162; Significance: 3e-86; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 303 - 464
Target Start/End: Original strand, 10725 - 10886
Alignment:
| Q |
303 |
ccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcagacaagtttatgatcaaggt |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10725 |
ccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcagacaagtttatgatcaaggt |
10824 |
T |
|
| Q |
403 |
gtggaagcttgcaagaataatttacatggtcgattagttatgaataagggaaacaaatcttt |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10825 |
gtggaagcttgcaagaataatttacatggtcgattagttatgaataagggaaacaaatcttt |
10886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 8e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 284 - 453
Target Start/End: Original strand, 18711195 - 18711367
Alignment:
| Q |
284 |
cttgttctttcgcacaagcccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcag |
383 |
Q |
| |
|
||||||| ||||||||||| || |||||| | |||||||| |||| |||||| ||||| |||||||||||||||||| ||||||| ||||||| |
|
|
| T |
18711195 |
cttgttccttcgcacaagctctatttaattctaatgatctcgccttcactcaattatcgaaaccctgcatcaaaggggattcaatttgcattaaactcat |
18711294 |
T |
|
| Q |
384 |
acaag---tttatgatcaaggtgtggaagcttgcaagaataatttacatggtcgattagttatgaataaggga |
453 |
Q |
| |
|
||||| ||||||||| |||||||||| ||||||||| |||||||| |||||||| ||||||| ||||||| |
|
|
| T |
18711295 |
acaagaagtttatgatcgcggtgtggaaggttgcaagaacaatttacacggtcgattggttatgagtaaggga |
18711367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 301 - 408
Target Start/End: Original strand, 15697808 - 15697916
Alignment:
| Q |
301 |
gcccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcagacaag-tttatgatcaa |
399 |
Q |
| |
|
|||||||| |||||||||||||| | | |||||| |||||| |||| ||||||||||||||| ||||||||||| ||||||| ||||| |||| ||| | |
|
|
| T |
15697808 |
gcccttgtaaattttgatgatctatctctcatgctattactgaaactttgcatcaaaggggactcagtttgcattaaactcacacaagacttataatcga |
15697907 |
T |
|
| Q |
400 |
ggtgtggaa |
408 |
Q |
| |
|
||||||||| |
|
|
| T |
15697908 |
ggtgtggaa |
15697916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 431
Target Start/End: Original strand, 27523471 - 27523515
Alignment:
| Q |
386 |
aagtttatgatcaaggtgtggaagcttgcaagaataatttacatgg |
431 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
27523471 |
aagtttgtgatcaaggtgtggaagcctgcaa-aataatttacatgg |
27523515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University