View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3693_low_35 (Length: 309)
Name: NF3693_low_35
Description: NF3693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3693_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 299
Target Start/End: Complemental strand, 21328206 - 21327921
Alignment:
| Q |
18 |
gatagagggtattttcctttgtaagagcttagcaccgtgtagggatattcattcatttgtatctacgttctttcttgaaaccattcacttctagtattcc |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21328206 |
gatagagggcattttcctttgtaagagcttagcaccgtatagggatattcattcatttgtatctacgttctttctagaaaccattcacttctagtattcc |
21328107 |
T |
 |
| Q |
118 |
attattgcagctatttcatgttatgtgttttttgtttgcatc----agcaacagttatttctttctgttattattagtaatagttatgttcattttgtaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21328106 |
attattgcagctatttcatgttatgtgttttttgtttgcatcagcgagcaacagttatttctttctgttattattagtaatagttatgttcattttgtaa |
21328007 |
T |
 |
| Q |
214 |
ttgtttacattcattgtttatgatttgannnnnnnnnnngtagctgcatatgcggtatgacgatgaaatatatgttgtttcctatg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21328006 |
ttgtttacattcattgtttatgatttgatttttttttttgtagctgcatatgcggtatgacgatgaaatatatgttgtttcctatg |
21327921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University